BBa_K115007 1 BBa_K115007 Temperature sensitive 5 2008-07-28T11:00:00Z 2015-05-08T01:09:28Z This sequence is taken from the Listeria Monocytogenes (EU372032.). It's the 5'UTR of a TF induced at 37 degrees. This part works as a thermoswitch the same as BBa_K115003. At low temperatures the RNA is folded into a structure that inhibits the Shine Dalgarno sequence. When the temperature rises, the RNA unfolds and the Shine Dalgarno sequence becomes exposed so that translation of the protein following this RNA can initiate. true false _223_ 0 3006 9 Discontinued false In contrast to BBa_K115003 a His-tag is added at the 3' end of the thermoswitch. We did this to shift the scar forward, otherwise the scar would alter the original RNA sequence. In case of part BBa_K115003 we left the scar inside the thermoswitch and altered the sequence in such a way that the predicted secundary structure remained the same. false Bastiaan van den Berg annotation1969137 1 start range1969137 1 116 118 annotation1969138 1 SD range1969138 1 106 109 annotation1969139 1 His-tag range1969139 1 122 151 BBa_K115007_sequence 1 tgtaaaaaatattatttagcgtgactttctttcaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattgggggatgagacatgggccatcatcatcatcatcatcatcatcatcacagcagcggccatatcgaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z