BBa_K115009 1 BBa_K115009 RNA thermometer (FourU) 2008-08-17T11:00:00Z 2015-05-08T01:09:28Z Salmonella Enterica Tyhpy (CP000886.1) This is a RNA-thermometer derived from FourU (BBa_K115002), to check effect of small changes in RNA-sequence on temperature sensitivity false false _223_ 0 3007 9 In stock true A few nucleotides have been altered from BBa_K115002 true O.M.J.A. Stassen annotation1972000 1 Scar adaptation range1972000 1 23 28 annotation1971997 1 Predicted stem loop range1971997 1 1 18 annotation1971999 1 SD range1971999 1 47 52 annotation1971998 1 Predicted stem loop range1971998 1 24 52 BBa_K115009_sequence 1 ggacaagcaatgcttgccttgaatggtaacttttgaatagtgattcaggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z