BBa_K115019 1 BBa_K115019 RNA thermometer (ROSE hairpin 32??C) 2008-08-19T11:00:00Z 2015-05-08T01:09:28Z ROSE hairpin. An RNA thermometer that theoretically switches on translation at 27 degrees Celcius and switched of translation below that temperature. Still to be tested. false false _223_ 0 3006 9 Not in stock false later. false Bastiaan van den Berg annotation1975867 1 SD range1975867 1 24 29 BBa_K115019_sequence 1 tgctcgtccagtctttgctcagtggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z