BBa_K115020 1 BBa_K115020 RNA thermometer (ROSE hairpin 37??C) 2008-08-19T11:00:00Z 2015-05-08T01:09:28Z ROSE hairpin. Released HQ 2013 An RNA thermometer that theoretically switches on translation at 37 degrees Celcius and switched of translation below that temperature. Still to be tested. false false _223_ 0 3006 9 In stock true later. true Bastiaan van den Berg annotation1972923 1 SD range1972923 1 24 29 BBa_K115020_sequence 1 tgctcgtcaagttcttgctccttggaggat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z