BBa_K1151000 1 BBa_K1151000 Nickel-responsive pleiotropic regulator (HpNikR) 2013-09-20T11:00:00Z 2015-05-08T01:09:28Z It was amplified by PCR from the genomic sequence of Helicobacter pylori G27. The HpNikR protein is a pleiotropic regulator from Helicobacter pylori. In presence of nickel it can acts as an activator or a repressor depending of the specific promoter that contains its operator sites. Each monomer consists in 133aa for a molecular weight of approximately 17.2 kDa. Apo-HpNikR is a tetramer able to bind up to six Ni2+ ions and then a conformational change allows it to activate or repress trascription. false false _1463_ 0 16632 9 Not in stock false It was inserted in a pET-15b plasmid vector, in order to have a better storage. false Emanuele Rizzo BBa_K1151000_sequence 1 atggatacacccaataaagacgattcaatcatccgcttttcggtttctttacaacaaaatttattagacgaattagacaaccgcatcattaaaaacggctattcttctcgctcagaattagtgcgcgacatgatcagagaaaaattagtagaagacaattgggccgaagataaccctaatgatgagagcaaaatcgccgtgcttgtggtgatttatgatcaccaccaaagggaattgaaccagcgcatgatagacattcagcatgccagcgggacgcatgttttatgcaccactcacattcacatggatgagcataattgtttagagacgattattttacaaggcaattcgtttgaaatccaacgcttgcaactagaaattggggggcttaggggggttaaattcgctaaattgactaaggcgtctagctttgaacacaatgaatag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z