BBa_K1151001 1 BBa_K1151001 Histidine-rich metal-binding protein 2013-09-20T11:00:00Z 2015-05-08T01:09:28Z synthesized by IDT (as gblock) So called for emphasize its origins in Helicobacter pylori and its avidity for nickel. Consisting of 60 aminoacids, the protein is rich in histidine (28 residues, 46.7 %) and contains short repeating motifs, it exists as an equilibration of multimeric forms in solution, with 20-mers (approx. 136 kDa) being the predominant species. Hpn can bind tightly and reversibly up to five Ni2+ ions per each monomer of 7 kDa in a pH-dependent manner (pH 7.4 ). In H. pylori play an important role in storing nickel required to the survival of the bacterium. false false _1463_ 0 16629 9 In stock false The gene is designed on H.pylori genomic sequence and amplified by PCR false Davide Magr?? BBa_K1151001_sequence 1 atggcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z