BBa_K1151002 1 BBa_K1151002 Double divergent promoter pnikR-pexbB 2013-09-20T11:00:00Z 2015-05-08T01:09:29Z This part comes from H. pylori genomic sequence and it was amplified by PCR. The nikR-exbB intergenic region from Helicobacter pylori conteins two single divergently oriented promoters, pnikR and pexbB. There are two operators for the HpNikR protein overlapping with the pnikR and pexbB promoters, respectively. These nucleotide sequences are linked by HpNikR (BBa_K1151000) in presence of nickel ions for repressing trascription. false false _1463_ 0 16632 9 Not in stock false The double divergent promoter was inserted i pGEM-T Easy. false Emanuele Rizzo BBa_K1151002_sequence 1 tgagaaaaatccttttttggcatgagttcgttaaaagccgctcatgctagtatgattgaattaatttaaaattaacaattataatacaaactggatttaaatggttggccataagagcgtttgaatttgattgtaattattagcttaatcatcattgacttgttattattaaaacaatacaatcaacaaaccaacattcttttatcattttggagcatttatgcgaacggatgcttcttatagggtgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z