BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K1151025 1 BBa_K1151025 RBS-Hpn-TER 2013-09-20T11:00:00Z 2015-05-08T01:09:29Z made in lab by Neb Assembly Kit It's only a ligation product between B0034 and K1151024 false false _1463_ 0 16629 9 Not in stock false none false Davide Magr?? component2357400 1 BBa_B0015 component2357393 1 BBa_K1151001 component2357392 1 BBa_B0034 annotation2357400 1 BBa_B0015 range2357400 1 209 337 annotation2357392 1 BBa_B0034 range2357392 1 1 12 annotation2357393 1 BBa_K1151001 range2357393 1 19 200 BBa_K1151001 1 BBa_K1151001 Histidine-rich metal-binding protein 2013-09-20T11:00:00Z 2015-05-08T01:09:28Z synthesized by IDT (as gblock) So called for emphasize its origins in Helicobacter pylori and its avidity for nickel. Consisting of 60 aminoacids, the protein is rich in histidine (28 residues, 46.7 %) and contains short repeating motifs, it exists as an equilibration of multimeric forms in solution, with 20-mers (approx. 136 kDa) being the predominant species. Hpn can bind tightly and reversibly up to five Ni2+ ions per each monomer of 7 kDa in a pH-dependent manner (pH 7.4 ). In H. pylori play an important role in storing nickel required to the survival of the bacterium. false false _1463_ 0 16629 9 In stock false The gene is designed on H.pylori genomic sequence and amplified by PCR false Davide Magr?? BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1151001_sequence 1 atggcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagtaa BBa_K1151025_sequence 1 aaagaggagaaatactagatggcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z