BBa_K1151000 1 BBa_K1151000 Nickel-responsive pleiotropic regulator (HpNikR) 2013-09-20T11:00:00Z 2015-05-08T01:09:28Z It was amplified by PCR from the genomic sequence of Helicobacter pylori G27. The HpNikR protein is a pleiotropic regulator from Helicobacter pylori. In presence of nickel it can acts as an activator or a repressor depending of the specific promoter that contains its operator sites. Each monomer consists in 133aa for a molecular weight of approximately 17.2 kDa. Apo-HpNikR is a tetramer able to bind up to six Ni2+ ions and then a conformational change allows it to activate or repress trascription. false false _1463_ 0 16632 9 Not in stock false It was inserted in a pET-15b plasmid vector, in order to have a better storage. false Emanuele Rizzo BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_K1151026 1 BBa_K1151026 HpNikR-TER 2013-09-20T11:00:00Z 2015-05-08T01:09:29Z None It's a biobrick composed of HpNikR-TER. false false _1463_ 0 16632 9 It's complicated false None false Emanuele Rizzo component2357442 1 BBa_K1151000 component2357449 1 BBa_B0015 annotation2357449 1 BBa_B0015 range2357449 1 456 584 annotation2357442 1 BBa_K1151000 range2357442 1 1 447 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1151026_sequence 1 atggatacacccaataaagacgattcaatcatccgcttttcggtttctttacaacaaaatttattagacgaattagacaaccgcatcattaaaaacggctattcttctcgctcagaattagtgcgcgacatgatcagagaaaaattagtagaagacaattgggccgaagataaccctaatgatgagagcaaaatcgccgtgcttgtggtgatttatgatcaccaccaaagggaattgaaccagcgcatgatagacattcagcatgccagcgggacgcatgttttatgcaccactcacattcacatggatgagcataattgtttagagacgattattttacaaggcaattcgtttgaaatccaacgcttgcaactagaaattggggggcttaggggggttaaattcgctaaattgactaaggcgtctagctttgaacacaatgaatagtactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1151000_sequence 1 atggatacacccaataaagacgattcaatcatccgcttttcggtttctttacaacaaaatttattagacgaattagacaaccgcatcattaaaaacggctattcttctcgctcagaattagtgcgcgacatgatcagagaaaaattagtagaagacaattgggccgaagataaccctaatgatgagagcaaaatcgccgtgcttgtggtgatttatgatcaccaccaaagggaattgaaccagcgcatgatagacattcagcatgccagcgggacgcatgttttatgcaccactcacattcacatggatgagcataattgtttagagacgattattttacaaggcaattcgtttgaaatccaacgcttgcaactagaaattggggggcttaggggggttaaattcgctaaattgactaaggcgtctagctttgaacacaatgaatag BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z