BBa_K1151001 1 BBa_K1151001 Histidine-rich metal-binding protein 2013-09-20T11:00:00Z 2015-05-08T01:09:28Z synthesized by IDT (as gblock) So called for emphasize its origins in Helicobacter pylori and its avidity for nickel. Consisting of 60 aminoacids, the protein is rich in histidine (28 residues, 46.7 %) and contains short repeating motifs, it exists as an equilibration of multimeric forms in solution, with 20-mers (approx. 136 kDa) being the predominant species. Hpn can bind tightly and reversibly up to five Ni2+ ions per each monomer of 7 kDa in a pH-dependent manner (pH 7.4 ). In H. pylori play an important role in storing nickel required to the survival of the bacterium. false false _1463_ 0 16629 9 In stock false The gene is designed on H.pylori genomic sequence and amplified by PCR false Davide Magr?? BBa_K1151035 1 BBa_K1151035 Hpn translational unit 2013-09-20T11:00:00Z 2015-05-08T01:09:29Z none A simple Hpn translational unit composed of B0034 (RBS)and K1151001 (hpn CDS) false false _1463_ 0 16629 9 Not in stock false none false Davide Magr?? component2357421 1 BBa_K1151001 component2357420 1 BBa_B0034 annotation2357420 1 BBa_B0034 range2357420 1 1 12 annotation2357421 1 BBa_K1151001 range2357421 1 19 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1151035_sequence 1 aaagaggagaaatactagatggcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagtaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K1151001_sequence 1 atggcacaccatgaagaacaacacggcggacaccaccaccatcaccatcacaacaccaccaccactaccatggcggcgaacaccaccatcaccaccacagctctcatcatgaagaaggttgttgtagcactagcgatagtcatcatcaagaagaaggttgctgccacgggcatcacgagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z