BBa_K1153000 1 BBa_K1153000 NorV promoter. NOx detector. 2013-09-19T11:00:00Z 2015-05-08T01:09:29Z E.coli genome. Our Biobrick has been designed to enable the detection of NO using the norV promoter, taken from the E.coli genome. In the presence of NOx it will promote the downstream genes in the plasmid, producing a protein in response to the environmental stimulus. false false _1465_ 0 18018 9 It's complicated false None false Kara Stubbs, David Hanly, Laura Carman, Sarah Dowie, Michael Coghlan, Rathaven Gunaratnarajah. BBa_K1153000_sequence 1 acggaaaaactcatctttgcctcactgtcaatttgactatagatattgtcatatcgaccatttgattgatagtcattttgactactcattaatgggcataattttatttatagagtaaaaacaatcagataaaaaactggcacgcaatctgcaattagcaagacatctttttagaacacgctgaataaattgaggttgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z