BBa_K1155000 1 BBa_K1155000 Pndh* 2013-09-04T11:00:00Z 2015-05-08T01:09:30Z Escherichia coli K12 genome sequence promoter region containing an operator and a promoter controlled by FNR that allow the repression of the downstream gene in anaerobic conditions false false _1467_ 0 14164 9 In stock true This promoter region correspond to a modified ndh promoter region of Escherichia coli. The second FNR binding site (FNRII) was modified to obtain a perfect consensus motif, improving the strength of the repression (Meng et al., 1997). false Sheng, Abdou Mouthare, Sylvie Lautru annotation2334983 1 FNRII range2334983 1 5 18 annotation2334985 1 +1 range2334985 1 106 106 annotation2334984 1 FNRI range2334984 1 49 62 BBa_K1155000_sequence 1 ttttttgatctcaatcaataaagtcgcctatcttttcagcaacaaaacttgattaacatcaattttggtatgaccaatgcaccattcatgttattctcaatagcgaagaac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z