BBa_K1155001 1 BBa_K1155001 Promoter region of bphR1 in Pseudomonas pseudoalcaligenes KF707 2013-09-15T11:00:00Z 2015-05-08T01:09:30Z genomic sequence of Pseudomonas pseudoalcaligenes KF707 promoter region of bphR1 from the bph operon of Pseudomonas pseudoalcaligenes KF707. Transcription of bphR1 has been proposed to be activated by BphR2 in presence of biphenyl. false false _1467_ 0 14164 9 In stock false 300 bp before the start codon of bphR1 false Eric Escriva, Sylvie Lautru BBa_K1155001_sequence 1 atgtccctgggtgacatgcgtgatttggccgccacgcggatcgcgctcgagagcgaagcgttacgccaaagcgtgctgaatggtgacgctgaatgggaggcgcggatcgtcagttcgtttcaccgactgtcattgattgaagagcccacgatgcgggatccggctcgctggtttaatgagtgggagccagtcaaccgcggttttcacgaagctcttatctctgcctgttcgtccgtctggatccggcggttcctgtccatcctgtatgtgcatatggagcgctaccgccgattgactgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z