BBa_K1155004 1 P(nirB) Promoter of nirB, activated by FNR in anaerobic conditions 2013-09-12T11:00:00Z 2015-05-08T01:09:30Z Escherichia coli K-12 substr. MG1655, web site EcoCyc http://www.ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG10653 Promoter of gene nirB from E. coli. Ectivated by FNR in anaerobic conditions and inactivated in aerobic conditions. The promoter of the gene nirB is regulated by FNR. It's a class II promoter with two FNR boxes. (Scott et al, FEBS letter, 2003) Aerobic conditions: +O2 --> FNR inactivated --> Promoter non activated Anaerobic conditions: - O2 --> FNR activated --> Promoter activated P(nirB) is predicted to be highly induced under anaerobic conditions :48-64 fold. (Lolesnikow et al, J. bacteriol 1992 / Griffiths et al, Arch. Microbiol. 1987 / Green et al, Mol. Microbiol, 1998) false false _1467_ 0 12594 9 In stock false We conserved all the promoter region until the last nucleotide before nirB ORF and approximately 100 bp before FNR boxes false Solenne Ithurbide, Abdou, Ana??s, Zhu annotation2340043 1 FNR box II range2340043 1 146 150 annotation2340041 1 FNR box I range2340041 1 137 141 BBa_K1155004_sequence 1 ctacgtgcatctatttctataaacccgctcattttgtctattttttgcacaaacatgaaatatcagacaattccgtgacttaagaaaatttatacaaatcagcaatatacccattaaggagtatataaaggtgaatttgatttacatcaataagcggggttgctgaatcgttaaggtaggcggtaatagaaaagaaatcgaggca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z