BBa_K1155006 1 BBa_K1155006 Promoter of narK activated by FNR in anaerobic condition 2013-09-12T11:00:00Z 2015-05-08T01:09:30Z Escherichia coli K-12 substr. MG1655, web site EcoCyc http://www.ecocyc.org/ECOLI/NEW-IMAGE?type=GENE&object=EG10642 Promoter of gene nirB from E. coli. Activated by FNR in anaerobic conditions and inactivated in aerobic conditions. The promoter of the gene narK is regulated by FNR. It's a class II promoter with two FNR boxes. (Scott et al, FEBS letter, 2003) Aerobic conditions: +O2 --> FNR inactivated --> Promoter non activated / Anaerobic conditions: - O2 --> FNR activated --> Promoter activated P(narK) is predicted to be highly induced under anaerobic conditions :48-64 fold. (Lolesnikow et al, J. bacteriol 1992 / Griffiths et al, Arch. Microbiol. 1987 / Green et al, Mol. Microbiol, 1998) false false _1467_ 0 12594 9 In stock false We conserved all the promoter region until the last nucleotide before narK ORF and approximately 100 bp before FNR boxes false Solenne Ithurbide, Abdou, Ana??s, Zhu, Xavier, Nadia annotation2340123 1 FNR box II ( atcaa) range2340123 1 128 132 annotation2340125 1 -35 ( tgcct) range2340125 1 134 139 annotation2340122 1 FNR box I ( ttgat) range2340122 1 119 123 annotation2340124 1 -10 ( taaggt) range2340124 1 154 159 BBa_K1155006_sequence 1 acatcggtaagggtagggattttacagcaccgtgaaaaatctcataatttttatgaagtcactgtactcactatgggtaatgataaatatcaatgatagataaagttatcttatcgtttgatttacatcaaattgcctttagctacagacactaaggtggcagacatcgaaacgagtatcagaggtgtct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z