BBa_K1159001 1 BBa_K1159001 NanoLuc Luciferase in RFC[25] 2013-05-16T11:00:00Z 2016-01-26T02:12:53Z x x false false _1471_ 4206 14732 9 In stock true x false TU Munich 2013 annotation2342942 1 NanoLuc Luciferase range2342942 1 1 510 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159304 1 BBa_K1159304 Signal Peptide of Ig Kappa chain from <i>Mus musculus</i> in RFC[25] N-part 2013-09-13T11:00:00Z 2015-06-11T01:54:39Z ''Mus musculus'' This part codes for the signal peptide of the Ig Kappa chain from ''Mus musculus''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for Physcomitrella patens which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341498 1 Consensus Sequence for P. patens range2341498 1 1 4 annotation2341499 1 Ig Kappa Signal Peptide range2341499 1 5 67 BBa_K1159006 1 BBa_K1159006 Secretory NanoLuc Luciferase (IgKappa-SigP_nLuc) in RFC[25] N-Part 2013-09-14T11:00:00Z 2015-05-28T03:52:04Z Synthetic NanoLuc Luciferase is engineered ATP-independent luciferase from a deep-sea shrimp which luminescense 2 magnitues higher than these from Renilla reniformis or from Photinus pyralis (firefly). Also the molecular weight of NanoLuc luciferase is twice smaller compared to other luciferase (only 19 kDa). This part encodes for a NanoLuc Luciferase which is fused to a N-terminal signal peptide for secretion (IgKappa signal peptide from Mus musculus) with also works in moss (Physcomitrella patens). This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 component2343006 1 BBa_K1159304 component2343010 1 BBa_K1159001 component2343008 1 BBa_K1159993 annotation2343010 1 BBa_K1159001 range2343010 1 74 583 annotation2343008 1 BBa_K1159993 range2343008 1 68 73 annotation2343006 1 BBa_K1159304 range2343006 1 1 67 BBa_K1159993_sequence 1 accggc BBa_K1159304_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgat BBa_K1159006_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgataccggcgtgttcaccctcgaggatttcgttggagattggagacagaccgctggatacaaccttgatcaggttttggagcagggtggtgtgtctagtcttttccagaacctcggagtgtctgtgacccctatccagagaatcgttctctctggtgagaacggactcaagatcgatatccacgtgatcatcccttacgagggactctcaggtgatcagatgggacagatcgagaagattttcaaggtggtgtaccctgttgatgatcaccacttcaaggtgatcctccactacggaactctcgtgatcgatggtgtgaccccaaacatgatcgattacttcggaaggccatacgagggaatcgctgtgttcgatggaaagaagattaccgttaccggaaccctctggaacggaaacaagattatcgatgagaggctcatcaaccctgatggatctctcttgttcagggtgaccatcaacggtgtgactggttggagactttgcgagagaatccttgct BBa_K1159001_sequence 1 gtgttcaccctcgaggatttcgttggagattggagacagaccgctggatacaaccttgatcaggttttggagcagggtggtgtgtctagtcttttccagaacctcggagtgtctgtgacccctatccagagaatcgttctctctggtgagaacggactcaagatcgatatccacgtgatcatcccttacgagggactctcaggtgatcagatgggacagatcgagaagattttcaaggtggtgtaccctgttgatgatcaccacttcaaggtgatcctccactacggaactctcgtgatcgatggtgtgaccccaaacatgatcgattacttcggaaggccatacgagggaatcgctgtgttcgatggaaagaagattaccgttaccggaaccctctggaacggaaacaagattatcgatgagaggctcatcaaccctgatggatctctcttgttcagggtgaccatcaacggtgtgactggttggagactttgcgagagaatccttgct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z