BBa_K648011 1 BBa_K648011 Standard 25-Ready Xyle Reporter 2011-07-03T11:00:00Z 2015-05-08T01:12:59Z The original genetic material for this part came from part BBa_K316007 which was mutated via PCR based site-directed mutagensis. The xyle portion of this large part was then amplified via PCR reaction and cloned into a new vector along with a prefix/suffix for standard 25 assembly. This is a mutated version of the Xyle reporter gene which encodes for the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This version of Xyle has been made compatible with standard 25 assembly methods by removing three restriction sites (two NgoMIV sites: at bp 315 and 486, as well as one AgeI site: at bp 837). These mutations were made synonymous with the original sequence and codon optimized for E. Coli. Because of the synonymous mutations, this gene can be easily used to create fusion protein parts. For more information on the Xyle gene and its uses as a reporter see part BBa_J33204. false false _825_ 0 9871 9 In stock true The mutations in this gene were made so that they were synonymous and codon optimized for E. coli cells. The part also contains the prefix/suffix for standard 25 assembly with addition restriction sites NgoMIV and AgeI. false Jim Rose annotation2122825 1 misc range2122825 1 1 918 BBa_K1159008 1 BBa_K1159008 Secretory Catechol-2,3-dioxygenase (IgKappa-SigP_XylE) in RFC[25] N-Part 2013-09-14T11:00:00Z 2015-05-08T01:09:30Z Synthetic This part encodes for the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This part is fused with a N-terminal signal peptide for secretion (Ig Kappa signal peptide from ''Mus musculus'') with also works in moss (''Physcomitrella patens''). This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 0 11507 9 In stock false x false Rosario CICCONE component2343619 1 BBa_K1159993 component2343621 1 BBa_K648011 component2343617 1 BBa_K1159304 annotation2343619 1 BBa_K1159993 range2343619 1 68 73 annotation2343621 1 BBa_K648011 range2343621 1 74 991 annotation2343617 1 BBa_K1159304 range2343617 1 1 67 BBa_K1159304 1 BBa_K1159304 Signal Peptide of Ig Kappa chain from <i>Mus musculus</i> in RFC[25] N-part 2013-09-13T11:00:00Z 2015-06-11T01:54:39Z ''Mus musculus'' This part codes for the signal peptide of the Ig Kappa chain from ''Mus musculus''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for Physcomitrella patens which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341498 1 Consensus Sequence for P. patens range2341498 1 1 4 annotation2341499 1 Ig Kappa Signal Peptide range2341499 1 5 67 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159993_sequence 1 accggc BBa_K1159304_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgat BBa_K648011_sequence 1 aacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccgccgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccagcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccagtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacc BBa_K1159008_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgataccggcaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccgccgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccagcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccagtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z