BBa_K243029 1 GSATLinker GSAT Linker 2009-10-19T11:00:00Z 2015-05-08T01:11:37Z Ordered by Mr.Gene. This part is a linker, it can be used to connect two parts and add additional space between these parts. That can be necessary to avoid interactions between these parts. The GSAT linker was create to connect our protein domains Fok_a and Fok_i to an function final construct. false true _352_ 0 4732 9 It's complicated false Designed for the fusion of proteins or peptides via in frame cloning, according to RFC25. false Freiburg Bioware09 annotation2055435 1 GSAT Linker range2055435 1 1 108 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159104 1 BBa_K1159104 N-terminal Phytochrome Interacting Factor 6 (PIF6) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Arabidopsis thaliana'' N-terminal Phytochrome Interacting Factor 6 (PIF6) is known to be recognized by Phytochrome B (PhyB) under red light exposition. This interaction between PhyB and PIF6 can be reverted by irradiation with far-red light. This part contains only the first 100 amino acid residues of PIF6 which is sufficient for light-dependent binding to PhyB. N- and C-terminal protein fusions seems not to affect the binding of PhyB. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2343343 1 PIF6 (2-100 AA) range2343343 1 1 297 BBa_K1159101 1 BBa_K1159101 N-terminal half of TEV Protease S219V mutant (for Split-TEV-Protease applications) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Tabacco Etch Virus'' N-terminal half of the TEV Protease (autolysis resistant S219V mutant) can be used for Split-TEV-Protease applications where autolysis of the reconstituted TEV Protease is not wanted. The necessary C-terminal half can be found under BBa_K1159102. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2341473 1 N-terminal half of TEV Protease range2341473 1 1 354 BBa_K1159108 1 BBa_K1159108 N-TEV-Protease_36AALinker_PIF6 (Second part for a light-switchable TEV-Protease) in RFC[25] 2013-09-15T11:00:00Z 2015-05-08T01:09:31Z Synthetic N-TEV-Protease_36AALinker_PIF6 (Second part for a light-switchable TEV-Protease) in RFC[25] false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2347101 1 BBa_K1159101 component2347107 1 BBa_K1159993 component2347109 1 BBa_K1159104 component2347105 1 BBa_K243029 component2347103 1 BBa_K1159993 annotation2347107 1 BBa_K1159993 range2347107 1 469 474 annotation2347109 1 BBa_K1159104 range2347109 1 475 771 annotation2347103 1 BBa_K1159993 range2347103 1 355 360 annotation2347101 1 BBa_K1159101 range2347101 1 1 354 annotation2347105 1 BBa_K243029 range2347105 1 361 468 BBa_K1159993_sequence 1 accggc BBa_K1159108_sequence 1 ggagaaagcttgtttaaggggccgcgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatctgatgggcacacaacatcgttgtatggtattggatttggtcccttcatcattacaaacaagcacttgtttagaagaaataatggaacactgttggtccaatcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaacacctcattgatgggagggacatgataattattcgcatgcctaaggatttcccaccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgcatatgtcttgtgacaaccaacttccaaactaccggcggtggttctgccggtggctccggttctggctccagcggtggcagctctggtgcgtccggcacgggtactgcgggtggcactggcagcggttccggtactggctctggcaccggcatgttcttaccaaccgattattgttgcaggttaagcgatcaagagtatatggagcttgtgtttgagaatggccagattcttgcaaagggccaaagatccaacgtttctctgcataatcaacgtaccaaatcgatcatggatttgtatgaggcagagtataacgaggatttcatgaagagtatcatccatggtggtggtggtgccatcacaaatctcggggacacgcaggttgttccacaaagtcatgttgctgctgcccatgaaacaaacatgttggaaagcaataaacatgttgac BBa_K243029_sequence 1 ggtggttctgccggtggctccggttctggctccagcggtggcagctctggtgcgtccggcacgggtactgcgggtggcactggcagcggttccggtactggctctggc BBa_K1159104_sequence 1 atgttcttaccaaccgattattgttgcaggttaagcgatcaagagtatatggagcttgtgtttgagaatggccagattcttgcaaagggccaaagatccaacgtttctctgcataatcaacgtaccaaatcgatcatggatttgtatgaggcagagtataacgaggatttcatgaagagtatcatccatggtggtggtggtgccatcacaaatctcggggacacgcaggttgttccacaaagtcatgttgctgctgcccatgaaacaaacatgttggaaagcaataaacatgttgac BBa_K1159101_sequence 1 ggagaaagcttgtttaaggggccgcgtgattacaacccgatatcgagcaccatttgtcatttgacgaatgaatctgatgggcacacaacatcgttgtatggtattggatttggtcccttcatcattacaaacaagcacttgtttagaagaaataatggaacactgttggtccaatcactacatggtgtattcaaggtcaagaacaccacgactttgcaacaacacctcattgatgggagggacatgataattattcgcatgcctaaggatttcccaccatttcctcaaaagctgaaatttagagagccacaaagggaagagcgcatatgtcttgtgacaaccaacttccaaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z