BBa_K1159110 1 BBa_K1159110 Thermonuclease with N-terminal SV40 NLS and flexible linker with TEV site in RFC[25] 2013-09-15T11:00:00Z 2015-05-08T01:09:31Z Synthetic This part encodes a micrococcal nuclease (Thermonuclease) with N-terminal SV40 Nuclear Localization Signal (SV40 NLS) and a flexible linker with a TEV cleavage site. Thermonuclease degrades ssDNA/dsDNA/ssRNA/dsRNA. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2347172 1 BBa_K1159109 component2347165 1 BBa_K1159993 component2347163 1 BBa_K1159310 annotation2347165 1 BBa_K1159993 range2347165 1 103 108 annotation2347172 1 BBa_K1159109 range2347172 1 109 618 annotation2347163 1 BBa_K1159310 range2347163 1 1 102 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159111 1 BBa_K1159111 Membrane-associated Thermonuclease NucA with TEV site and SV40 NLS in RFC[25] N-Part 2013-09-15T11:00:00Z 2015-05-08T01:09:31Z Synthetic This part encodes a membrane-associated Thermonuclease NucA for the chassis ''Physcomitrella patens''. NucA is a endo/exonuclease that degrades ssDNA/dsDNA/ssRNA/dsRNA. It cannot execute its deadly potential when it is bound to the cytoplasmatic membrane. The region between NucA and the transmembrane domain consists a long linker with a TEV cleavage site and a SV40 nuclear localization signal (NLS). By cleaving the TEV cleavage site with a TEV Protease the nuclease NucA translocates in the nucleus due to its SV40 NLS and degrades the genomic DNA resulting a inevitable induction of programmed cell-death (PCD). This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2347345 1 BBa_K1159993 component2347343 1 BBa_K1159314 component2347358 1 BBa_K1159110 annotation2347345 1 BBa_K1159993 range2347345 1 293 298 annotation2347358 1 BBa_K1159110 range2347358 1 299 916 annotation2347343 1 BBa_K1159314 range2347343 1 1 292 BBa_K1159314 1 BBa_K1159314 TMD with N-terminal Signal Peptide of SERK Receptor from ''P. patens'' in RFC[25] N-Part 2013-09-15T11:00:00Z 2015-06-11T01:53:32Z Synthetic This part codes for the Transmembrane Domain with N-terminal Signal Peptide of SERK Receptor from ''P. patens'' in RFC[25]. This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 4206 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2347281 1 BBa_K1159303 component2347285 1 BBa_K1159305 component2347283 1 BBa_K1159993 annotation2347281 1 BBa_K1159303 range2347281 1 1 100 annotation2347283 1 BBa_K1159993 range2347283 1 101 106 annotation2347285 1 BBa_K1159305 range2347285 1 107 292 BBa_K1159105 1 BBa_K1159105 Mature Nuclease NucA from <i>Staphylococcus aureus</i> (Thermonuclease) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Staphylococcus aureus'' Thermonuclease is a endo-exonuclease from ''Staphylococcus aureus'' that degrades dsDNA, ssDNA, dsRNA and ssRNA. This part is coding the mature form of the nuclease, also called NucA. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2343335 1 Mature Thermonuclease (NucA) range2343335 1 1 447 BBa_K1159305 1 BBa_K1159305 Transmembrane domain of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:11Z ''Physcomitrella patens'' This part is encoding the transmembrane region of the SERK Receptor from ''Physcomitrella patens''. For membrane translocation a N-terminal signal peptide is still necessary for translocation through the ER membrane. This part is flanked by RFC[25] pre- and suffix. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2343588 1 Transmembrane Domain of SERK Receptor from ''P. patens'' range2343588 1 1 186 BBa_K1159109 1 BBa_K1159109 Micrococcal nuclease (Thermonuclease) with N-terminal SV40 NLS in RFC[25] 2013-09-15T11:00:00Z 2015-05-08T01:09:31Z Synthetic This part encodes a micrococcal nuclease (Thermonuclease) with N-terminal SV40 Nuclear Localization Signal (SV40 NLS). Thermonuclease degrades ssDNA/dsDNA/ssRNA/dsRNA. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2347156 1 BBa_K801030 component2347160 1 BBa_K1159105 component2347158 1 BBa_K1159993 annotation2347156 1 BBa_K801030 range2347156 1 1 57 annotation2347158 1 BBa_K1159993 range2347158 1 58 63 annotation2347160 1 BBa_K1159105 range2347160 1 64 510 BBa_K801030 1 BBa_K801030 Polypeptide containing SV40 nuclear localization sequence (SV40 NLS) for nuclear translocation 2012-09-20T11:00:00Z 2015-05-08T01:13:24Z designed by oligo hybridisation based on plasmid "pGADT7 AD" from Clontech, w/ RFC25-pre and suffix for protein fusions SV40NLS nuclear localization sequence false false _1057_ 0 11507 9 In stock false - false Dong-Jiunn Jeffery TRUONG annotation2198843 1 SV40 nuclear localization sequence (recognized by importin alpha) range2198843 1 22 42 BBa_K1159303 1 BBa_K1159303 Signal Peptide of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:49Z ''Physcomitrella patens'' This part codes for the signal peptide from the SERK receptor (Somatic Embryogenesis RECEPTOR KINAS) of ''Physocmitrella patens''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for ''Physcomitrella patens'' which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341512 1 Consensus Sequence for ''P. patens'' range2341512 1 1 4 annotation2341513 1 SERK Signal Peptide range2341513 1 5 100 BBa_K1159310 1 BBa_K1159310 34 AA flexible linker with C-terminal TEV cleavage site (GGGGS)x5-TEV-site-linker) in RFC[25] 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic This part encodes a 34 amino acids long flexible linker ((GlyGlyGlyGlySer)x5) with a C-terminal cleavage site for the TEV Protease. For further protein fusions this part is flanked by RFC[25} pre- and suffix. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2342592 1 TEV cleavage site range2342592 1 79 99 annotation2342593 1 (GlyGlyGlySer)x5 range2342593 1 1 75 BBa_K801030_sequence 1 gcggaattaattcccgagcctccaaaaaagaagagaaaggtcgaattgggtaccgcc BBa_K1159993_sequence 1 accggc BBa_K1159303_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacacc BBa_K1159110_sequence 1 ggtggaggcggttcaggcggaggtggctctggcggtggcggatcgggaggcggtggctccggaggtggaggctcaggagagaatttgtattttcagtcaggaaccggcgcggaattaattcccgagcctccaaaaaagaagagaaaggtcgaattgggtaccgccaccggcgcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaa BBa_K1159109_sequence 1 gcggaattaattcccgagcctccaaaaaagaagagaaaggtcgaattgggtaccgccaccggcgcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaa BBa_K1159305_sequence 1 cctggacaacctccttttcctcctcctcctccttttacaccacctcctccacaaactcctaacggtgcttctggtgagaactctactggtgctattgctggtggtgttgctgctggtgcagctcttttgtttgctgctcctgctattggattcgcttggtggagaagaagaaggcctattgaggct BBa_K1159105_sequence 1 gcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaa BBa_K1159314_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacaccaccggccctggacaacctccttttcctcctcctcctccttttacaccacctcctccacaaactcctaacggtgcttctggtgagaactctactggtgctattgctggtggtgttgctgctggtgcagctcttttgtttgctgctcctgctattggattcgcttggtggagaagaagaaggcctattgaggct BBa_K1159111_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacaccaccggccctggacaacctccttttcctcctcctcctccttttacaccacctcctccacaaactcctaacggtgcttctggtgagaactctactggtgctattgctggtggtgttgctgctggtgcagctcttttgtttgctgctcctgctattggattcgcttggtggagaagaagaaggcctattgaggctaccggcggtggaggcggttcaggcggaggtggctctggcggtggcggatcgggaggcggtggctccggaggtggaggctcaggagagaatttgtattttcagtcaggaaccggcgcggaattaattcccgagcctccaaaaaagaagagaaaggtcgaattgggtaccgccaccggcgcaacttcaactaaaaaattacataaagaacctgcgactttaattaaagcgattgatggtgatacggttaaattaatgtacaaaggtcaaccaatgacattcagactattattggttgatacacctgaaacaaagcatcctaaaaaaggtgtagagaaatatggtcctgaagcaagtgcatttacgaaaaaaatggtagaaaatgcaaagaaaattgaagtcgagtttgacaaaggtcaaagaactgataaatatggacgtggcttagcgtatatttatgctgatggaaaaatggtaaacgaagctttagttcgtcaaggcttggctaaagttgcttatgtttacaaacctaacaatacacatgaacaacatttaagaaaaagtgaagcacaagcgaaaaaagagaaattaaatatttggagcgaagacaacgctgattcaggtcaa BBa_K1159310_sequence 1 ggtggaggcggttcaggcggaggtggctctggcggtggcggatcgggaggcggtggctccggaggtggaggctcaggagagaatttgtattttcagtcagga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z