BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159204 1 BBa_K1159204 Secretory SpyCatcher (SERK-SigP_SpyCatcher) in RFC[25] N-Part 2013-09-16T11:00:00Z 2015-06-11T01:59:58Z Synthetic This part encodes the SpyCatcher [http://parts.igem.org/Part:BBa_K1159200 BBa_K1159200] with a N-terminal signal peptide for secretion (SERK receptor signal peptide from ''Physcomitrella patens''). This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 4206 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2348881 1 BBa_K1159993 component2348886 1 BBa_K1159200 component2348879 1 BBa_K1159303 annotation2348881 1 BBa_K1159993 range2348881 1 101 106 annotation2348886 1 BBa_K1159200 range2348886 1 107 445 annotation2348879 1 BBa_K1159303 range2348879 1 1 100 BBa_K1159200 1 BBa_K1159200 Splitted and engineered N-terminal FbaB for isopeptide bound formation (SpyCatcher) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Streptococcus pyogenes'' This part codes for a protein that recognizes and forms a covalent isopeptide bound to a oligopeptide. That oligopeptide can be found under BBa_K1159201. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2343366 1 Reactive Lys for isopeptide forming reaction range2343366 1 91 93 annotation2343345 1 N-terminal FbaB (modified SpyCatcher) range2343345 1 1 339 annotation2343348 1 Iso --> Glu range2343348 1 100 102 annotation2343349 1 Met --> Tyr range2343349 1 205 207 BBa_K1159303 1 BBa_K1159303 Signal Peptide of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:49Z ''Physcomitrella patens'' This part codes for the signal peptide from the SERK receptor (Somatic Embryogenesis RECEPTOR KINAS) of ''Physocmitrella patens''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for ''Physcomitrella patens'' which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341512 1 Consensus Sequence for ''P. patens'' range2341512 1 1 4 annotation2341513 1 SERK Signal Peptide range2341513 1 5 100 BBa_K1159993_sequence 1 accggc BBa_K1159204_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacaccaccggcgttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatt BBa_K1159200_sequence 1 gttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatt BBa_K1159303_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z