BBa_K1159303 1 BBa_K1159303 Signal Peptide of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:49Z ''Physcomitrella patens'' This part codes for the signal peptide from the SERK receptor (Somatic Embryogenesis RECEPTOR KINAS) of ''Physocmitrella patens''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for ''Physcomitrella patens'' which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341513 1 SERK Signal Peptide range2341513 1 5 100 annotation2341512 1 Consensus Sequence for ''P. patens'' range2341512 1 1 4 BBa_K1159205 1 BBa_K1159205 Secretory SpyTag (SERK-SigP_SpyTag) in RFC[25] N-Part 2013-09-16T11:00:00Z 2015-06-11T01:59:37Z Synthetic This part encodes the SpyTag [http://parts.igem.org/Part:BBa_K1159201 BBa_K1159201] with a N-terminal signal peptide for secretion (SERK receptor signal peptide from ''Physcomitrella patens''). This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 4206 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2348900 1 BBa_K1159993 component2348898 1 BBa_K1159303 component2348903 1 BBa_K1159201 annotation2348903 1 BBa_K1159201 range2348903 1 107 145 annotation2348900 1 BBa_K1159993 range2348900 1 101 106 annotation2348898 1 BBa_K1159303 range2348898 1 1 100 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159201 1 BBa_K1159201 Splitted and engineered C-terminal FbaB for isopeptide bound formation (SpyTag) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Streptococcus pyogenes'' This part codes for a oligopeptide that is recognized and bound by a covalent isopeptide bound to a protein, called SpyCatcher. That catcher protein for this oligopeptdie can be found under BBa_K1159200. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2343512 1 Reactive Asp for isopeptide forming reaction range2343512 1 19 21 annotation2343481 1 SpyTag range2343481 1 1 39 BBa_K1159993_sequence 1 accggc BBa_K1159303_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacacc BBa_K1159205_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacaccaccggcgctcatattgtcatggttgatgcttacaagccaactaag BBa_K1159201_sequence 1 gctcatattgtcatggttgatgcttacaagccaactaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z