BBa_K1159211 1 BBa_K1159211 Secretory SpyCatcher_nLuc fusion (IgKappa-SigP_SpyCatcher_nLuc) in RFC[25] N-Part 2013-09-16T11:00:00Z 2015-05-08T01:09:31Z Synthetic Secretory Fusionprotein consisting N-terminal SpyCatcher and C-terminal nLuc (IgKappa-SigP_SpyCatcher_nLuc) in RFC[25] N-Part. This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2350314 1 BBa_K1159993 component2350316 1 BBa_K1159001 component2350312 1 BBa_K1159202 annotation2350316 1 BBa_K1159001 range2350316 1 419 928 annotation2350314 1 BBa_K1159993 range2350314 1 413 418 annotation2350312 1 BBa_K1159202 range2350312 1 1 412 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159202 1 BBa_K1159202 Secretory SpyCatcher (IgKappa-SigP_SpyCatcher) in RFC[25] N-Part 2013-09-15T11:00:00Z 2015-06-11T02:00:29Z Synthetic This part encodes the SpyCatcher [http://parts.igem.org/Part:BBa_K1159200 BBa_K1159200] with a N-terminal signal peptide for secretion (Ig Kappa signal peptide from ''Mus musculus'') which also works in moss ''Physcomitrella patens''. This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 4206 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2348476 1 BBa_K1159304 component2348483 1 BBa_K1159200 component2348478 1 BBa_K1159993 annotation2348483 1 BBa_K1159200 range2348483 1 74 412 annotation2348476 1 BBa_K1159304 range2348476 1 1 67 annotation2348478 1 BBa_K1159993 range2348478 1 68 73 BBa_K1159001 1 BBa_K1159001 NanoLuc Luciferase in RFC[25] 2013-05-16T11:00:00Z 2016-01-26T02:12:53Z x x false false _1471_ 4206 14732 9 In stock true x false TU Munich 2013 annotation2342942 1 NanoLuc Luciferase range2342942 1 1 510 BBa_K1159200 1 BBa_K1159200 Splitted and engineered N-terminal FbaB for isopeptide bound formation (SpyCatcher) in RFC[25] 2013-09-13T11:00:00Z 2015-05-08T01:09:31Z ''Streptococcus pyogenes'' This part codes for a protein that recognizes and forms a covalent isopeptide bound to a oligopeptide. That oligopeptide can be found under BBa_K1159201. This part is flanked by RFC[25] pre- and suffix for further protein fusions. false false _1471_ 0 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG annotation2343349 1 Met --> Tyr range2343349 1 205 207 annotation2343348 1 Iso --> Glu range2343348 1 100 102 annotation2343345 1 N-terminal FbaB (modified SpyCatcher) range2343345 1 1 339 annotation2343366 1 Reactive Lys for isopeptide forming reaction range2343366 1 91 93 BBa_K1159304 1 BBa_K1159304 Signal Peptide of Ig Kappa chain from <i>Mus musculus</i> in RFC[25] N-part 2013-09-13T11:00:00Z 2015-06-11T01:54:39Z ''Mus musculus'' This part codes for the signal peptide of the Ig Kappa chain from ''Mus musculus''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for Physcomitrella patens which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341499 1 Ig Kappa Signal Peptide range2341499 1 5 67 annotation2341498 1 Consensus Sequence for P. patens range2341498 1 1 4 BBa_K1159993_sequence 1 accggc BBa_K1159304_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgat BBa_K1159200_sequence 1 gttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatt BBa_K1159001_sequence 1 gtgttcaccctcgaggatttcgttggagattggagacagaccgctggatacaaccttgatcaggttttggagcagggtggtgtgtctagtcttttccagaacctcggagtgtctgtgacccctatccagagaatcgttctctctggtgagaacggactcaagatcgatatccacgtgatcatcccttacgagggactctcaggtgatcagatgggacagatcgagaagattttcaaggtggtgtaccctgttgatgatcaccacttcaaggtgatcctccactacggaactctcgtgatcgatggtgtgaccccaaacatgatcgattacttcggaaggccatacgagggaatcgctgtgttcgatggaaagaagattaccgttaccggaaccctctggaacggaaacaagattatcgatgagaggctcatcaaccctgatggatctctcttgttcagggtgaccatcaacggtgtgactggttggagactttgcgagagaatccttgct BBa_K1159211_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgataccggcgttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatattaccggcgtgttcaccctcgaggatttcgttggagattggagacagaccgctggatacaaccttgatcaggttttggagcagggtggtgtgtctagtcttttccagaacctcggagtgtctgtgacccctatccagagaatcgttctctctggtgagaacggactcaagatcgatatccacgtgatcatcccttacgagggactctcaggtgatcagatgggacagatcgagaagattttcaaggtggtgtaccctgttgatgatcaccacttcaaggtgatcctccactacggaactctcgtgatcgatggtgtgaccccaaacatgatcgattacttcggaaggccatacgagggaatcgctgtgttcgatggaaagaagattaccgttaccggaaccctctggaacggaaacaagattatcgatgagaggctcatcaaccctgatggatctctcttgttcagggtgaccatcaacggtgtgactggttggagactttgcgagagaatccttgct BBa_K1159202_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgataccggcgttgataccttatcaggtttatcaagtgagcaaggtcagtccggtgatatgacaattgaagaagatagtgctacccatattaaattctcaaaacgtgatgaggacggcaaagagttagctggtgcaactatggagttgcgtgattcatctggtaaaactattagtacatggatttcagatggacaagtgaaagatttctacctgtatccaggaaaatatacatttgtcgaaaccgcagcaccagacggttatgaggtagcaactgctattacctttacagttaatgagcaaggtcaggttactgtaaatggcaaagcaactaaaggtgacgctcatatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z