BBa_K1159303 1 BBa_K1159303 Signal Peptide of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:49Z ''Physcomitrella patens'' This part codes for the signal peptide from the SERK receptor (Somatic Embryogenesis RECEPTOR KINAS) of ''Physocmitrella patens''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for ''Physcomitrella patens'' which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341512 1 Consensus Sequence for ''P. patens'' range2341512 1 1 4 annotation2341513 1 SERK Signal Peptide range2341513 1 5 100 BBa_K1159303_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacacc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z