BBa_K1159304 1 BBa_K1159304 Signal Peptide of Ig Kappa chain from <i>Mus musculus</i> in RFC[25] N-part 2013-09-13T11:00:00Z 2015-06-11T01:54:39Z ''Mus musculus'' This part codes for the signal peptide of the Ig Kappa chain from ''Mus musculus''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for Physcomitrella patens which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341499 1 Ig Kappa Signal Peptide range2341499 1 5 67 annotation2341498 1 Consensus Sequence for P. patens range2341498 1 1 4 BBa_K1159304_sequence 1 aacaatggaaaccgatactctcctcctctgggttctcttgctttgggttccaggatctaccggcgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z