BBa_K1159303 1 BBa_K1159303 Signal Peptide of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:49Z ''Physcomitrella patens'' This part codes for the signal peptide from the SERK receptor (Somatic Embryogenesis RECEPTOR KINAS) of ''Physocmitrella patens''. The signal peptide induces translocation of the protein into the Endoplasmatic Reticulum (ER) for secretion or membrane integration. Protein fused to the C-terminus of this part should be secreted or otherwise if the part fused region contains a transmembrane domain it will be integrated in cytoplasmatic membrane. This part starts with a consensus sequence for ''Physcomitrella patens'' which allows efficient translation start. Furthermore, this part is flanked by RFC[25] N-part pre- and suffix for fusions to the C-terminus of this part. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2341513 1 SERK Signal Peptide range2341513 1 5 100 annotation2341512 1 Consensus Sequence for ''P. patens'' range2341512 1 1 4 BBa_K1159314 1 BBa_K1159314 TMD with N-terminal Signal Peptide of SERK Receptor from ''P. patens'' in RFC[25] N-Part 2013-09-15T11:00:00Z 2015-06-11T01:53:32Z Synthetic This part codes for the Transmembrane Domain with N-terminal Signal Peptide of SERK Receptor from ''P. patens'' in RFC[25]. This construct is flanked by RFC[25] N-part prefix and suffix. Note: This means only protein fusions to the C-terminus of this part is possible, adding promoters (typically RFC[10]) into the prefix or terminators/IRES (typically RFC[10]) into the suffix of this part is nevertheless possible. false false _1471_ 4206 11507 9 In stock false x false Dong-Jiunn Jeffery TRUONG component2347285 1 BBa_K1159305 component2347281 1 BBa_K1159303 component2347283 1 BBa_K1159993 annotation2347285 1 BBa_K1159305 range2347285 1 107 292 annotation2347283 1 BBa_K1159993 range2347283 1 101 106 annotation2347281 1 BBa_K1159303 range2347281 1 1 100 BBa_K1159993 1 BBa_K1159993 25/25 Assembly Scar 2013-09-14T11:00:00Z 2015-05-08T01:09:31Z Synthetic Assembly scar between RFC[25] Biobrick and RFC[25] Biobrick. false false _1471_ 0 11507 9 Not in stock false x false TU Munich 2013 annotation2342863 1 25/25 scar range2342863 1 1 6 BBa_K1159305 1 BBa_K1159305 Transmembrane domain of SERK Receptor from <i>Physcomitrella patens</i> in RFC[25] 2013-09-13T11:00:00Z 2015-06-11T01:54:11Z ''Physcomitrella patens'' This part is encoding the transmembrane region of the SERK Receptor from ''Physcomitrella patens''. For membrane translocation a N-terminal signal peptide is still necessary for translocation through the ER membrane. This part is flanked by RFC[25] pre- and suffix. false false _1471_ 4206 11507 9 In stock false x false TU Munich 2013 annotation2343588 1 Transmembrane Domain of SERK Receptor from ''P. patens'' range2343588 1 1 186 BBa_K1159993_sequence 1 accggc BBa_K1159303_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacacc BBa_K1159305_sequence 1 cctggacaacctccttttcctcctcctcctccttttacaccacctcctccacaaactcctaacggtgcttctggtgagaactctactggtgctattgctggtggtgttgctgctggtgcagctcttttgtttgctgctcctgctattggattcgcttggtggagaagaagaaggcctattgaggct BBa_K1159314_sequence 1 aacaatgcctggtgaagttgcttggtggaggcctcttttccttatcgctcttatgcctatcggagtgctctctaacgctgagggtgatgctcttaacaccaccggccctggacaacctccttttcctcctcctcctccttttacaccacctcctccacaaactcctaacggtgcttctggtgagaactctactggtgctattgctggtggtgttgctgctggtgcagctcttttgtttgctgctcctgctattggattcgcttggtggagaagaagaaggcctattgaggct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z