BBa_K1161005 1 Vio E Violacein E 2013-09-11T11:00:00Z 2015-05-08T01:09:32Z See above Violacein E (Vio)E is the first of 5 protein coding sequences contained in the Violacein operon originally derived from the organism, Chromobacterium violaceum. The entire operon was submitted to the registry by the Cambridge team in 2009 as K274002. Together these five proteins form a metabolic pathway that produces the violet pigment violacein when expressed in E. coli. Like its other four partners we have appended the coding sequence with the ribosome binding site BBa_B003 so that operons that vary in gene order can be created by standard assembly means. Here we use these parts to show gene order affects pigment colour. false false _1473_ 0 17484 9 It's complicated false See above false Michael Esau annotation2355511 1 cds range2355511 1 22 597 annotation2355493 1 B0030 range2355493 1 1 15 annotation2355497 1 Spe/Pst range2355497 1 16 21 BBa_K1161005_sequence 1 attaaagaggagaaatactagatggagaaccgtgagccaccactgttgccagcccgttggagcagcgcctatgtctcttattggagcccgatgctgccggatgaccagctgaccagcggctattgctggttcgactatgaacgtgacatctgtcgtattgacggcctgttcaatccgtggagcgagcgtgatactggttatcgcctgtggatgtcggaggttggtaatgcggccagcggccgtacctggaaacaaaaagtcgcctatggtcgtgagcgtaccgccctgggtgaacagctgtgtgagcgtccgctggatgatgagactggcccttttgccgaattgttcctgccacgcgatgtcctgcgccgtctgggtgcccgtcacattggccgtcgcgtggttctgggtcgcgaagcggacggttggcgttaccagcgcccaggtaaaggtccgagcaccctgtacctggatgcggcgagcggcactccactgcgcatggtcaccggcgatgaagcgtcgcgtgcaagcctgcgtgattttccgaatgtgagcgaggcggagatcccggacgcggttttcgcggccaagcgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z