BBa_J36835 1 BBa_J36835 Lipoprotein signal peptide 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 genome This codes for the 20-amino-acid signal peptide and the 1st nine amino acids of lipoprotein. When fused with another protein downstream, the signal peptide should target the protein to the outer membrane of E. coli, facing the periplasm. This part was fused with OmpA(aa46-66) and OmpA(aa46-159) in trying to express streptavidin protein on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock true There is no spacer nucleotide between the part and the SpeI restriction site, so that after BioBricks assembly, the mixed site is 6 base pairs, and the reading frame is maintained between protein domains. false Perry Tsai BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961224 1 -35 range1961224 1 137 142 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961226 1 LacI binding site range1961226 1 166 200 BBa_J36836 1 BBa_J36836 Outer membrane protein A, aa 46-66 2006-10-28T11:00:00Z 2015-08-31T04:08:47Z E. coli K12 This part codes for amino acids #46-66 of outer membrane protein A (OmpA). It corresponds to a single transmembrane domain of OmpA, crossing the outer membrane of E. coli. This was fused with the lipoprotein signal peptide upstream and streptavidin downstream in the project to express streptavidin on the outer surface of E. coli. false false _65_ 0 1229 65 Not in stock false There are no spacer nucleotides between the part and the XbaI restriction site, or between the part and the SpeI restriction site, so that the mixed site would be 6bp long, and reading frame would be maintained between protein domains. false Perry Tsai BBa_K116102 1 BBa_K116102 IPTG inducible membrane protein generator 2008-10-29T12:00:00Z 2015-05-08T01:09:32Z BBa_J36848 This construct contains lac promoter (R0010), ribosome binding site (BBa_R0034), Lpp (lipoprotein signal peptide, OmpA, (transmembrane domains), respectively. It is an IPTG inducible device to express membrane protein. false false _210_ 0 592 9 Not in stock false We design primers to extract the DNA segment excluding the Streptavidin from BBa_J36848. false Chih-Hsien Yang component1996936 1 BBa_B0034 component1996937 1 BBa_J36835 component1996928 1 BBa_R0010 component1996938 1 BBa_J36836 annotation1996938 1 BBa_J36836 range1996938 1 322 384 annotation1996936 1 BBa_B0034 range1996936 1 209 220 annotation1996937 1 BBa_J36835 range1996937 1 227 313 annotation1996928 1 BBa_R0010 range1996928 1 1 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K116102_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcagtactagagaacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J36835_sequence 1 atgaaagctactaaactggtactgggcgcggtaatcctgggttctactctgctggcaggttgctccagcaacgctaaaatcgatcag BBa_J36836_sequence 1 aacccgtatgttggctttgaaatgggttacgactggttaggtcgtatgccgtacaaaggcagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z