BBa_K1162009 1 BBa_K1162009 10x-Histidine (10x-His) Tag with Met (ATG) For N-terminal purification 2013-09-14T11:00:00Z 2015-05-08T01:09:32Z E. coli This part uses assembly standard 23 (RFC 23-silver fusion) to allow for protein fusions. This 10x His Tag is similar to BBa_K844000 but has the double stop codon (TAA TAA) removed unlike BBa_K844000. (http://parts.igem.org/wiki/index.php?title=Part:BBa_K844000). Another characteristic of this part is the presence of a Met (ATG) for direct His Tag and protein expression. Since the presence of the Met (ATG) this His Tag should be used for protein purification at the N-terminal. The user can place a promoter-rbs system of their choice in front of this His Tag for direct expression. The lack of any stop codon in this His Tag allows the user to add additional features downstream of the gene e.g. secretion tag or GFP (note, the gene itself must not contain any stop codons if the His Tag is to be used like this). Related parts BBa_K844000 (http://parts.igem.org/wiki/index.php?title=Part:BBa_K844000), this link also provides an extensive review of existing Histidine Tags in the Parts Registry. false false _1474_ 0 9404 9 It's complicated true RFC 23 and contains an atg (met). No stop codon. false Kathleen Miller annotation2343739 1 start range2343739 1 1 3 BBa_K1162010 1 BBa_K1162010 promoter+rbs and N-terminal 10x His Tag 2013-09-14T11:00:00Z 2015-05-08T01:09:32Z E. coli This promoter 10x His Tag system allows the user to place the protein they wish to be purified directly onto the back end of this construct. The user must be aware that the gene they were to express must be RFC 23 otherwise the expression system will be out of frame. Also the gene of interest should contain a stop codon at the end. false false _1474_ 0 9404 9 It's complicated false None. false Kathleen Miller component2343746 1 BBa_K208010 component2343748 1 BBa_K1162009 annotation2343746 1 BBa_K208010 range2343746 1 1 220 annotation2343748 1 BBa_K1162009 range2343748 1 227 259 BBa_K208010 1 BBa_K208010 Lac Promoter (BBa_R0010) and RBS (B0034) 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z synthetic Released HQ 2013 lac + rbs false false _310_ 0 3473 9 In stock true none false Elisabeth Linton annotation2034625 1 BBa_B0034 range2034625 1 209 220 annotation2034626 1 BBa_R0010 range2034626 1 1 200 BBa_K1162009_sequence 1 atgcatcatcaccatcaccaccatcatcaccat BBa_K1162010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgcatcatcaccatcaccaccatcatcaccat BBa_K208010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z