BBa_K1162014 1 BBa_K1162014 protmoter+rbs+N-terminal 10x His-Tag+GFP with no translational stop codon 2013-09-16T11:00:00Z 2015-05-08T01:09:32Z GFP is synthetic form of GFP from a Jellyfish (Aequorea victoria). N-terminal 10x His-Tag fused with GFP (no translational stop codon) to allow for N-terminal HT-GFP tagged protein fusion. RFC 23 allows for in frame fusion on the C-terminal end of GFP. false false _1474_ 0 13965 9 It's complicated false RFC 23. ATG(Met) at start on coding region. false Ryan Putman component2351205 1 BBa_K1162011 component2351203 1 BBa_K1162010 annotation2351205 1 BBa_K1162011 range2351205 1 266 982 annotation2351203 1 BBa_K1162010 range2351203 1 1 259 BBa_K1162011 1 BBa_K1162011 GFP with stop codon removed 2013-09-14T11:00:00Z 2015-05-08T01:09:32Z E. coli Improves upon the original GFP (BBa_K208000) by removing the stop codon. This allows for C terminal addition to this construct. For example purification/secretion tag or a protein fusion with GFP. This GFP confers to RFC 23 silver fusion standard. false false _1474_ 0 9404 9 It's complicated false RFC 23 standards used. Stop codon from BBa_K208000 removed. false Kathleen Miller annotation2343983 1 start range2343983 1 1 3 BBa_K1162010 1 BBa_K1162010 promoter+rbs and N-terminal 10x His Tag 2013-09-14T11:00:00Z 2015-05-08T01:09:32Z E. coli This promoter 10x His Tag system allows the user to place the protein they wish to be purified directly onto the back end of this construct. The user must be aware that the gene they were to express must be RFC 23 otherwise the expression system will be out of frame. Also the gene of interest should contain a stop codon at the end. false false _1474_ 0 9404 9 It's complicated false None. false Kathleen Miller component2343748 1 BBa_K1162009 component2343746 1 BBa_K208010 annotation2343748 1 BBa_K1162009 range2343748 1 227 259 annotation2343746 1 BBa_K208010 range2343746 1 1 220 BBa_K208010 1 BBa_K208010 Lac Promoter (BBa_R0010) and RBS (B0034) 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z synthetic Released HQ 2013 lac + rbs false false _310_ 0 3473 9 In stock true none false Elisabeth Linton annotation2034625 1 BBa_B0034 range2034625 1 209 220 annotation2034626 1 BBa_R0010 range2034626 1 1 200 BBa_K1162009 1 BBa_K1162009 10x-Histidine (10x-His) Tag with Met (ATG) For N-terminal purification 2013-09-14T11:00:00Z 2015-05-08T01:09:32Z E. coli This part uses assembly standard 23 (RFC 23-silver fusion) to allow for protein fusions. This 10x His Tag is similar to BBa_K844000 but has the double stop codon (TAA TAA) removed unlike BBa_K844000. (http://parts.igem.org/wiki/index.php?title=Part:BBa_K844000). Another characteristic of this part is the presence of a Met (ATG) for direct His Tag and protein expression. Since the presence of the Met (ATG) this His Tag should be used for protein purification at the N-terminal. The user can place a promoter-rbs system of their choice in front of this His Tag for direct expression. The lack of any stop codon in this His Tag allows the user to add additional features downstream of the gene e.g. secretion tag or GFP (note, the gene itself must not contain any stop codons if the His Tag is to be used like this). Related parts BBa_K844000 (http://parts.igem.org/wiki/index.php?title=Part:BBa_K844000), this link also provides an extensive review of existing Histidine Tags in the Parts Registry. false false _1474_ 0 9404 9 It's complicated true RFC 23 and contains an atg (met). No stop codon. false Kathleen Miller annotation2343739 1 start range2343739 1 1 3 BBa_K1162014_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgcatcatcaccatcaccaccatcatcaccattactagatggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaa BBa_K1162009_sequence 1 atgcatcatcaccatcaccaccatcatcaccat BBa_K1162010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgcatcatcaccatcaccaccatcatcaccat BBa_K1162011_sequence 1 atggctagcaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgctacatacggaaagcttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttctcttatggtgttcaatgcttttcccgttatccggatcatatgaaacggcatgactttttcaagagtgccatgcccgaaggttatgtacaggaacgcactatatctttcaaagatgacgggaactacaagacgcgtgctgaagtcaagtttgaaggtgatacccttgttaatcgtatcgagttaaaaggtattgattttaaagaagatggaaacattctcggacacaaactcgagtacaactataactcacacaatgtatacatcacggcagacaaacaaaagaatggaatcaaagctaacttcaaaattcgccacaacattgaagatggatccgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtcgacacaatctgccctttcgaaagatcccaacgaaaagcgtgaccacatggtccttcttgagtttgtaactgctgctgggattacacatggcatggatgagctctacaaa BBa_K208010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z