BBa_K1163101 1 BBa_K1163101 pAceB promoter region 2013-09-21T11:00:00Z 2015-08-03T03:10:42Z Genomic DNA. Promoter from E. coli that controls the AceB gene, involved in iron uptake and iron sensitive. FUR (Ferric Uptake Regulation) is a transcriptional repressor of genes involved in iron homeostasis. In presence of iron, the FUR protein changes its conformation and dimerizes. This leads to the binding to the DNA on a FUR binding site, thus inhibiting the mRNA transcription. Why would you use this part? This promoter allows you to have an iron-sensitive behaviour. In fact, in the presence of iron, the Fes promoter region decreases the expression of the downstream gene. false false _1475_ 4206 14862 9 Not in stock true We blindly extracted the 300 bp sequence upstream of the AceB gene in E. coli. It contains a putative FUR binding site and a putative RBS. false Emiel van der Kouwe annotation2358132 1 pAceB range2358132 1 1 300 BBa_K1163101_sequence 1 atctacggcacatgaatccaacgctggattaatcttctgtgatagtcgatcgttaagcgattcagcaccttacctcaggcaccttcgggtgccttttttatttccgaaacgtacctcagcaggtgaataaattttattcatattgttatcaacaagttatcaagtatttttaattaaaatggaaattgtttttgattttgcattttaaatgagtagtcttagttgtgctgaacgaaaagagcacaacgatccttcgttcacagtggggaagttttcggatccatgacgaggagctgcacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z