BBa_K1163104 1 BBa_K1163104 FepA promoter region 2013-09-21T11:00:00Z 2015-05-08T01:09:32Z Genomic sequence Promoter from E. coli that controls the FepA gene, involved in iron uptake and iron sensitive. FUR (Ferric Uptake Regulation) is a transcriptional repressor of genes involved in iron homeostasis. In presence of iron, the FUR protein changes its conformation and dimerizes. This leads to the binding to the DNA on a FUR binding site, thus inhibiting the mRNA transcription.<br> Why would you use this part?<br> This promoter allows you to have an iron-sensing behaviour. In fact, in the presence of iron, the FepA promoter region decreases the expression of the downstream gene.<br> false false _1475_ 0 14862 9 Not in stock false We blindly extracted the 320 bp sequence upstream of the FepA gene in E. coli. It contains a putative FUR binding site and a putative RBS. false Emiel van der Kouwe annotation2358138 1 FepA range2358138 1 1 320 BBa_K1163104_sequence 1 ttcgtcattcagacgctgccattccgggccatgtttcgactgccaccagctctcacttcctacttttaacgccgtcacaccataaccccatgtttactgtgcaatttttcattgattgcagaaatatattgataatattattgataactatttgcatttgcaatagcgtaatggcgcgccgtgggaagcgcggacattaattaaccaactgcactgcgtgtctttcaggatcaaaggttttcgcggtagcgggatgcgtcgtgttgatgacgaccatgcccgacagttgcaattcgtggcaaaaatgcaggaataaaaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z