BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1163107 1 BBa_K1163107 Fes promoter region 2013-09-21T11:00:00Z 2015-08-03T03:09:26Z Genomic DNA. Promoter from E. coli that controls the Fes gene, involved in iron uptake and iron sensitive. FUR (Ferric Uptake Regulation) is a transcriptional repressor of genes involved in iron homeostasis. In presence of iron, the FUR protein changes its conformation and dimerizes. This leads to the binding to the DNA on a FUR binding site, thus inhibiting the mRNA transcription. Why would you use this part? This promoter allows you to have an iron-sensitive behaviour. In fact, in the presence of iron, the Fes promoter region decreases the expression of the downstream gene. false false _1475_ 4206 14862 9 Not in stock false We blindly extracted the 298 bp sequence upstream of the Fes gene in E. coli. It contains a putative FUR binding site and a putative RBS. false Emiel van der Kouwe annotation2358151 1 Fes range2358151 1 1 298 BBa_K1163002 1 BBa_K1163002 sfGFP-Term 2013-09-21T11:00:00Z 2015-05-08T01:09:32Z DNA synthesis Superfolder Green Fluorescent Protein (sfGFP) coding sequence concatenated with a RBS sequence. This part is characterized when coupled to the following promoter regions: AceB in K1163101 FepA in K1163104 Fes in K1163107 YncE in K11631010 false false _1475_ 0 14862 9 Not in stock false None false Emiel van der Kouwe component2358112 1 BBa_K1163001 component2358119 1 BBa_B0015 annotation2358112 1 BBa_K1163001 range2358112 1 1 720 annotation2358119 1 BBa_B0015 range2358119 1 729 857 BBa_K1163108 1 BBa_K1163108 Fes-sfGFP-Term 2013-09-21T11:00:00Z 2015-05-08T01:09:32Z Golden Gate assembly between BBa_K1163107 and BBa_K1163002 Promoter from E. coli that controls the Fes gene, involved in iron uptake. This promoter sequence contains a RBS and a FUR binding site, although it is not clearly possible to identify them precisely. It has been shown to downregulate the expression of sfGFP or any gene down-stream in the presence of iron in the range: 10^-7 to 10^-4 mol.L^-1 FUR (Ferric Uptake Regulation) is a transcriptional repressor of genes involved in iron homeostasis. In presence of iron FUR will be linked to the iron. This modification of conformation will induce a dimerization of FUR. Then the dimeric FUR will bind to the DNA in a Fur Binding Site and inhibit the mRNA transcription. To realize our project we want to use this Fur binding site merged with an inhibitor (here LacI) to create an inverter system. Fes regulatory promoter will decrease the expression of the LacI-LVA gene (LacI protein with a LVA degredation tag) when the FUR protein is dimerized in the presence of iron. This part should be used to express a gene of interest that is under control of a Lac operator (LacO). This way, the gene will be positively regulated in the presence of iron. false false _1475_ 0 14862 9 It's complicated false None. false Emiel van der Kouwe component2358163 1 BBa_K1163002 component2358153 1 BBa_K1163107 annotation2358153 1 BBa_K1163107 range2358153 1 1 298 annotation2358163 1 BBa_K1163002 range2358163 1 305 1161 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 BBa_K1163001 1 BBa_K1163001 sfGFP 2013-09-21T11:00:00Z 2015-05-08T01:09:32Z DNA synthesis Superfolder Green Fluorescent Protein (sfGFP) coding sequence. This part is characterized when coupled to the folowing promoter regions: AceB in K1163101 FepA in K1163103 Fes in K1163105 YncE in K1163107 false false _1475_ 0 14862 9 Not in stock false None false Emiel van der Kouwe annotation2358097 1 sfGFP range2358097 1 1 720 BBa_K1163108_sequence 1 gccacgaattgcaactgtcgggcatggtcgtcatcaacacgacgcatcccgctaccgcgaaaacctttgatcctgaaagacacgcagtgcagttggttaattaatgtccgcgcttcccacggcgcgccattacgctattgcaaatgcaaatagttatcaataatattatcaatatatttctgcaatcaatgaaaaattgcacagtaaacatggggttatggtgtgacggcgttaaaagtaggaagtgagagctggtggcagtcgaaacatggcccggaatggcagcgtctgaatgacgtactagatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1163002_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1163001_sequence 1 atgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaataataa BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1163107_sequence 1 gccacgaattgcaactgtcgggcatggtcgtcatcaacacgacgcatcccgctaccgcgaaaacctttgatcctgaaagacacgcagtgcagttggttaattaatgtccgcgcttcccacggcgcgccattacgctattgcaaatgcaaatagttatcaataatattatcaatatatttctgcaatcaatgaaaaattgcacagtaaacatggggttatggtgtgacggcgttaaaagtaggaagtgagagctggtggcagtcgaaacatggcccggaatggcagcgtctgaatgacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z