BBa_K1163400 1 BBa_K1163400 AceB promoter, iron sensitive, down-regulated by dimerized FUR protein 2013-09-21T11:00:00Z 2015-05-08T01:09:32Z Extracted form genomic sequence of E. coli MG1655 Promoter from E. coli that controls the AceB gene, involved in iron uptake. This promoter sequence contains a RBS and a FUR binding site, although it is not clearly possible to identify them precisely. It has been shown to downregulate the expression of sfGFP or any gene down-stream in the presence or iron in the range 10^-7, 10^-5 mol.L-1 false false _1475_ 0 14862 9 Not in stock false Impossible to idengitfy the RBS and FUR binding site precisely false Emiel van der Kouwe annotation2357894 1 Putative shine-delgarno sequence range2357894 1 285 294 BBa_K1163400_sequence 1 atctacggcacatgaatccaacgctggattaatcttctgtgatagtcgatcgttaagcgattcagcaccttacctcaggcaccttcgggtgccttttttatttccgaaacgtacctcagcaggtgaataaattttattcatattgttatcaacaagttatcaagtatttttaattaaaatggaaattgtttttgattttgcattttaaatgagtagtcttagttgtgctgaacgaaaagagcacaacgatccttcgttcacagtggggaagttttcggatccatgacgaggagctgcacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z