BBa_K116501 1 BBa_K116501 RpaA(regulator of phycobilisome-associated) 2008-10-28T12:00:00Z 2015-05-08T01:09:33Z Synechococcus elongatus PCC7942 The SasA???RpaA signal transduction system represents an activation output pathway from the cyanobacteria Kai oscillator. SasA is transfer its phosphoryl group to RpaA, which is predicted to activate this RR. false false _210_ 0 2083 9 Not in stock false The binding affinity to DNA still have to be confirmed false Chun-Ju Yang BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_K116500 1 BBa_K116500 OmpF promoter that is activated or repressesed by OmpR according to osmolarity. 2008-10-28T12:00:00Z 2015-05-08T01:09:33Z Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo larity, OmpF predominates in the outer membrane, while at high osmolarity the OmpF porin is replaced by OmpC.OmpF has a larger pore and a faster ??ow rate than OmpC. Promoter OmpF is activated by phosphorylated OmpR at low osmolarity, and is repressesed by phosphorylated OmpR at high osmolarity.In Escherichia coli, osmoregulation is mediated in part by the actions of such a two-component system consisting of EnvZ and OmpR. These proteins act to control the relative levels of the outer membrane porin genes, ompF and ompC. At low osmo larity, OmpF predominates in the outer membrane, while at high osmolarity the OmpF porin is replaced by OmpC.OmpF has a larger pore and a faster ??ow rate than OmpC. Reference: K. Mattison, R. Oropeza, N. Byers, L. J. Kenney, J Mol Biol 315, 497 (Jan 25, 2002). false false _210_ 0 2083 9 It's complicated false The osmolarity range of OmpF sensing still have to be confirmed false Chun-Ju Yang annotation1994040 1 OmpR binding range1994040 1 27 88 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K116520 1 BBa_K116520 GFP under control of RpaA activated pOmpF promoter 2008-10-28T12:00:00Z 2015-05-08T01:09:33Z BBa_K116510 BBa_K116511 GFP under control of RpaA activated pOmpF promoter false false _210_ 0 2083 9 It's complicated false N. Takai et al., Proc Natl Acad Sci U S A 103, 12109 (Aug 8, 2006). false Chun-Ju Yang component1995093 1 BBa_R0040 component1995083 1 BBa_B0032 component1995086 1 BBa_E0040 component1995081 1 BBa_K116500 component1995099 1 BBa_B0034 component1995089 1 BBa_B0012 component1995100 1 BBa_K116501 component1995087 1 BBa_B0010 annotation1995087 1 BBa_B0010 range1995087 1 882 961 annotation1995100 1 BBa_K116501 range1995100 1 1099 1848 annotation1995089 1 BBa_B0012 range1995089 1 970 1010 annotation1995086 1 BBa_E0040 range1995086 1 154 873 annotation1995093 1 BBa_R0040 range1995093 1 1019 1072 annotation1995083 1 BBa_B0032 range1995083 1 135 147 annotation1995081 1 BBa_K116500 range1995081 1 1 126 annotation1995099 1 BBa_B0034 range1995099 1 1081 1092 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K116501_sequence 1 atgaaaccccgcatcctcgtgatcgatgatgactcagccatcttggagctggtcgccgtcaatctggagatgtctggctatgacgtacgcaaagctgaggacggcattaaaggtcaggctttagctgttcagctagttcccgacctgatcatgctggatctaatgctgccgcgggttgatggctttaccgtctgtcagcgactgcggcgcgatgagcgtactgccgaaattccggtgctgatgctgaccgccctcggacagactcaggataaggttgaaggcttcaacgcgggtgctgacgattatctgactaagcccttcgaagttgaagagatgctggcccgcgtgcgtgccttgctgcggcgcaccgatcgcattccccatgcagcccgccatagcgaaattctcagctacggtccgctgaccctgattcccgagcggtttgaggccatttggttcaaccgcacggtcaagctgactcacttggaatttgagttgttgcactgcctgttgcaacgccacggccaaacggttgcgccgagcgaaatcctcaaagaagtctggggctatgatcccgacgatgacatcgagacgattcgcgtccacatccgtcatctgcgcaccaagctcgagcccgatccccggcacccgcgctacatcaaaacggtctatggagcgggctactgccttgagctgccggccgagacggaactccaccaacacgccgatcagtttccttcggcgtcctga BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_B0032_sequence 1 tcacacaggaaag BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_K116520_sequence 1 gacggtgttcacaaagttccttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgctactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaccccgcatcctcgtgatcgatgatgactcagccatcttggagctggtcgccgtcaatctggagatgtctggctatgacgtacgcaaagctgaggacggcattaaaggtcaggctttagctgttcagctagttcccgacctgatcatgctggatctaatgctgccgcgggttgatggctttaccgtctgtcagcgactgcggcgcgatgagcgtactgccgaaattccggtgctgatgctgaccgccctcggacagactcaggataaggttgaaggcttcaacgcgggtgctgacgattatctgactaagcccttcgaagttgaagagatgctggcccgcgtgcgtgccttgctgcggcgcaccgatcgcattccccatgcagcccgccatagcgaaattctcagctacggtccgctgaccctgattcccgagcggtttgaggccatttggttcaaccgcacggtcaagctgactcacttggaatttgagttgttgcactgcctgttgcaacgccacggccaaacggttgcgccgagcgaaatcctcaaagaagtctggggctatgatcccgacgatgacatcgagacgattcgcgtccacatccgtcatctgcgcaccaagctcgagcccgatccccggcacccgcgctacatcaaaacggtctatggagcgggctactgccttgagctgccggccgagacggaactccaccaacacgccgatcagtttccttcggcgtcctga BBa_K116500_sequence 1 gacggtgttcacaaagttccttaaattttacttttggttacatattttttctttttgaaaccaaatctttatctttgtagcactttcacggtagcgaaacgttagtttgaatggaaagatgcctgc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z