BBa_K1166003 1 BBa_K1166003 His-TAT 2013-09-16T11:00:00Z 2015-05-08T01:09:33Z We took the sequences needed for these part from a sequence alignment. A biobrick that includes the TAT signal peptide that can be fused to any protein for an easy internalization into mammal cells. It includes a 6x His-tag for easy purification. TAT is a cell penetrating peptide (CPP) derived from the transactivator of transcription from HIV and has been used to internalize a range of large and small molecules from peptides, DNA and antibodies, to liposomes. false false _1478_ 0 13053 9 In stock false We include a 6x Histidine tag for purification. TAT peptide is ready to be fused at N-terminal region. false Luis Mario Leal Garza annotation2351487 1 start range2351487 1 1 3 annotation2351493 1 linker range2351493 1 85 114 annotation2351489 1 linker range2351489 1 22 51 annotation2351488 1 His-tag range2351488 1 4 21 annotation2351492 1 TAT range2351492 1 52 84 BBa_K1166003_sequence 1 atgcatcaccatcaccatcacggcggtggcggtagcggcggtggcggttcttatggccgcaaaaagcgtcgccagcgtcgccgtggcggtggcggtagcggcggtggcggttct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z