BBa_K116609 1 CIIICd CIIICd: modified CIII coding region from &#955; phage 2008-10-29T12:00:00Z 2015-05-08T01:09:33Z &#955; phage CIIICd: A modified version of the CIII coding region from ''&lambda; phage''. '''Original CIII''': '''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC''' '''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC AAACACTTATGGCTATCCAGAC</font>'''TAA''' The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon). false false _210_ 0 2749 9 It's complicated false HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since Hadler ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. false Jesse Wu BBa_K116609_sequence 1 atgccttccgaatctttacttgaacgaatcacccgtaaattacgtgacggatggaaacgccttatcgacatacttaatcagccaggataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z