BBa_K116619 1 BBa_K116619 CIIICd + BBa_B0015 2008-10-30T12:00:00Z 2015-05-08T01:09:33Z ligation CIIICd + T. false false _210_ 0 2749 9 It's complicated false BBa_K116609 BBa_B0015 false Jesse Wu component1997801 1 BBa_B0010 component1997800 1 BBa_K116609 component1997803 1 BBa_B0012 annotation1997803 1 BBa_B0012 range1997803 1 187 227 annotation1997800 1 BBa_K116609 range1997800 1 1 90 annotation1997801 1 BBa_B0010 range1997801 1 99 178 BBa_K116609 1 CIIICd CIIICd: modified CIII coding region from &#955; phage 2008-10-29T12:00:00Z 2015-05-08T01:09:33Z &#955; phage CIIICd: A modified version of the CIII coding region from ''&lambda; phage''. '''Original CIII''': '''ATG'''<font color="gray">CAATATGCCATTGCAGGGTGGCCTGTTGCTGGCTGC</font>'''CCTTCCGAATCTTTACTTGAACGAATCACCC''' '''GTAAATTACGTGACGGATGGAAACGCCTTATCGACATACTTAATCAGCCAGGAG'''<font color="gray">TCCCAAAGAATGGATC AAACACTTATGGCTATCCAGAC</font>'''TAA''' The protein domains from the left-most and right-most side of CIII have been removed (the grayed out parts), i.e. amino acid residues #2-13 and #42-49 have been excluded, leaving residues #1 (start codon), #14-41 (the protein domain in the middle) and #55 (stop codon). false false _210_ 0 2749 9 It's complicated false HtlB also degrades CIII, creating competitive degradation reactions. We removed the leftmost and right most protein domains since Hadler ''et al'' said that removing these two protein domains will stop HtlB from degrading CIII. Doing this makes it easier to predict and model. false Jesse Wu BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K116619_sequence 1 atgccttccgaatctttacttgaacgaatcacccgtaaattacgtgacggatggaaacgccttatcgacatacttaatcagccaggataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K116609_sequence 1 atgccttccgaatctttacttgaacgaatcacccgtaaattacgtgacggatggaaacgccttatcgacatacttaatcagccaggataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z