BBa_K1170000 1 BBa_K1170000 asr (acid shock response) promoter 2013-09-01T11:00:00Z 2015-05-08T01:09:34Z This part was extracted from the genome of E. coli K12 An acid inducible promoter of the acid shock response (asr) gene, extracted from E. coli K12. This part can be used to generate pH based response in any biological system. false false _1483_ 0 16731 9 Not in stock false The sequence provided in literature indicated a consensus sequence for the Pho Box just before the transcription start site false Rohit Satija annotation2334964 1 Pho Box range2334964 1 114 131 annotation2334962 1 asr promoter range2334962 1 1 178 annotation2334963 1 TATA box range2334963 1 141 147 BBa_K1170000_sequence 1 cgatcaagactactattattggtagctaaatttcccttaagtcacaatacgttattatcaacgctgtaatttattcagcgtttgtacatatcgttacacgctgaaaccaaccactcacggaagtctgccattcccagggatatagttatttcaacggccccgcagtggggttaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z