BBa_K608002 1 BBa_K608002 strong Promoter and strong RBS 2011-09-14T11:00:00Z 2015-05-08T01:12:52Z assembly from iGEM parts Released HQ 2013 you can insert your part behind this part so it will be immediatly expressed in e.coli. false false _780_ 0 9115 9 In stock false cloning via 3a-assembly false Julia M??ller component2128646 1 BBa_J23104 component2128648 1 BBa_B0034 annotation2128646 1 BBa_J23104 range2128646 1 1 35 annotation2128648 1 BBa_B0034 range2128648 1 44 55 BBa_J23104 1 BBa_J23104 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z isolated from library of promoters replace later false false _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1172506 1 BBa_K1172506 oprF with strong Promoter and strong RBS 2013-08-27T11:00:00Z 2015-05-08T01:09:34Z false false _1485_ 0 16785 9 In stock false false Sebastian Grenz component2332979 1 BBa_K608002 annotation2332979 1 BBa_K608002 range2332979 1 1 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K608002_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_K1172506_sequence 1 ttgacagctagctcagtcctaggtattgtgctagctactagagaaagaggagaaa BBa_J23104_sequence 1 ttgacagctagctcagtcctaggtattgtgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z