BBa_K1173500 1 BBa_K1173500 <i>ompC</i> w/ cyan 2013-09-19T11:00:00Z 2015-05-08T01:09:35Z Assembled using standard 3A Assembly ompF is a specific promoter which is only activated when phosphorylated OmpR (OmpR-P) is present. OmpR is phosphorylated by the protein Cph8 (form by two proteins, Cph1 and EnvZ), which is usually associated with osmotic regulation. Cph8 is also responsive to red light; exposure to red light halts the phosphorylation of OmpR. The lack of OmpR-P means the ompF promoter is not actiavted, so the genes which follow it are not transcribed. There is a cyan pigment after ompF, which has the nucleotide sequence from BBa_K592011. The pigment will be produced in most generally used competant cells, as Cph8 is present in their outer membranes for osmotic regulation. To control the levels of cyan pigment produced, we recommend the use of EnvZ deficient cells and introducing the genes which code for Cph8 on a LCN plasmid. This would allow control of cyan pigment production using only red light. false false _1486_ 0 18234 9 It's complicated false Be aware of ompF being activated by the cells' osmolarity, rather than exposure to red light. false paul james component2367138 1 BBa_B0034 component2367140 1 BBa_K592011 component2367136 1 BBa_R0082 annotation2367140 1 BBa_K592011 range2367140 1 135 836 annotation2367138 1 BBa_B0034 range2367138 1 117 128 annotation2367136 1 BBa_R0082 range2367136 1 1 108 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592011 1 cjBlue cjBlue, green chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z Cnidopus japonicus This chromoprotein, cjBlue, naturally exhibits strong green/blue color when expressed. Compared to amilCP(BBa_K592009) and amilGFP(BBa_K592010), the color development is slower. On agar plates and in liquid culture, the color is readily visible to naked eye after 24-48 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 In stock false Codon-optimization for expression in E.coli necessary. false Antonio Ascue Avalos annotation2131787 1 cjBlue range2131787 1 1 699 BBa_R0082 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000193 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompC. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes the three OmpR binding sites: C1, C2, and C3. The promoter starts at -107 and goes up to the transcriptional start site at +1. An alternate version, BBa_R0083, cuts out the C2 and C3 sites. The efficacy of this promoter versus the truncated ompC upstream region (BBa_R0083) or the ompF upstream region (BBa_R0084) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301154 1 C1 OmpR range301154 1 13 30 annotation301166 1 -35 range301166 1 75 80 annotation301156 1 C3 OmpR range301156 1 54 71 annotation301167 1 -10 range301167 1 98 103 annotation301155 1 C2 OmpR range301155 1 34 51 BBa_K1173500_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacttactagagaaagaggagaaatactagatggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa BBa_R0082_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggact BBa_B0034_sequence 1 aaagaggagaaa BBa_K592011_sequence 1 atggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z