BBa_K1175005 1 BBa_K1175005 endo-1,4-beta-xylanase xynA from Bacillus Subtilis Subtilis 168 2013-09-26T11:00:00Z 2015-05-08T01:09:35Z his gene has been isolated from the bacterium Bacillus subtilis subtilis 168 The endo-1,4-beta-xylanase gene xynA cleaves xylan polysaccharide chains to form shorter xylan chains. This gene has been isolated from the bacterium Bacillus subtilis subtilis 168. Usage and Biology Xylan is a molecule similar to cellulose, and after cellulose the most abundant biomass material on earth. It is a major structural component of plant cell walls. Furthermore, xylan crosslinks with cellulose and other cell wall components, inhibiting access of cellulases (1). Xylose is the sugar monomer of xylan as glucose is to cellulose. Xylose cannot be used in the human body as a source of energy. Endo-1,4-beta-xylanase (xynA) breaks the xylan chains into shorter chains, and may be stearically hindered by side chains (2). A beta-xylanase such as Endo-1,4-beta xylanase may be used to degrade xylan to facilitate cellulase activity. Another use may be in conjunction with an exo-xylanase to efficiently break down xylan into xylose monomers (a pentose sugar). Enzymatic Activity of Gene Product As stated above, the function of the gene product is xylan degredation. The enzyme's catabolic activity results from endohydrolysis of 1,4-beta-D-xylosidic linkages in xylan molecules (4). (1) http://newscenter.lbl.gov/feature-stories/2012/11/12/a-better-route-to-xylan/ (2) http://www.nutrex.be/sites/default/files/wysiwyg-upload/nutrase-xyla-nsp-enzyme.pdf (3) http://subtiwiki.uni-goettingen.de/wiki/index.php/XynA (4) http://www.uniprot.org/uniprot/P18429 false false _1488_ 0 14098 9 Not in stock false A second stop codon was added. false Nicholas K. Goldner annotation2365334 1 XynA range2365334 1 4 639 annotation2365335 1 Stop Codon range2365335 1 640 645 annotation2365333 1 Start Codon range2365333 1 1 3 BBa_K1175005_sequence 1 atgtttaagtttaaaaagaatttcttagttggattatcggcagctttaatgagtattagcttgttttcggcaaccgcctctgctgctagcacagactactggcaaaattggactgatgggggcggtatagtaaacgctgtcaatgggtctggcgggaattacagtgttaattggtctaataccggaaattttgttgttggtaaaggttggactacaggttcgccatttaggacgataaactataatgccggagtttgggcgccgaatggcaatggatatttaactttatatggttggacgagatcacctctcatagaatattatgtagtggattcatggggtacttatagacctactggaacgtataaaggtactgtaaaaagtgatgggggtacatatgacatatatacaactacacgttataacgcaccttccattgatggcgatcgcactacttttacgcagtactggagtgttcgccagtcgaagagaccaaccggaagcaacgctacaatcactttcagcaatcatgtgaacgcatggaagagccatggaatgaatctgggcagtaattgggcttaccaagtcatggcgacagaaggatatcaaagtagtggaagttctaacgtaacagtgtggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z