BBa_K118001 1 appY appY coding sequence encoding a DNA-binding transcriptional activator 2008-07-21T11:00:00Z 2015-05-08T01:09:36Z Escherichia coli JM109 genomic DNA. Released HQ 2013 This is the coding sequence of appY from Escherichia coli JM109. It encodes a transcriptional regulator related to anaerobic energy metabolism. Overexpression of the gene has been reported to result in enhanced lycopene production by E. coli (Kang et al., 2005). false false _192_ 0 3282 9 In stock true No special considerations. true Andrew Hall annotation1995700 1 appY coding sequence range1995700 1 1 750 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938045 1 SacI range1938045 1 1 3 annotation1938046 1 rbs range1938046 1 4 10 BBa_K118007 1 BBa_K118007 rbs+appY (encoding a DNA-binding transcriptional activator) 2008-08-07T11:00:00Z 2015-05-08T01:09:36Z Escherichia coli JM109 genomic DNA. Released HQ 2013 This is the coding sequence of appY from Escherichia coli JM109 preceded by a synthetic ribosome binding site (rbs). It encodes a transcriptional regulator related to anaerobic energy metabolism. Overexpression of the gene has been reported to result in enhanced lycopene production by E. coli (Kang et al., 2005). false false _192_ 0 3282 9 In stock true No special considerations true Andrew Hall component1970368 1 BBa_K118001 component1970367 1 BBa_J15001 annotation1970368 1 BBa_K118001 range1970368 1 17 769 annotation1970367 1 BBa_J15001 range1970367 1 1 10 BBa_K118001_sequence 1 atggattatgtttgctccgtagttttcatctgtcaatcatttgatttaattataaacaggagagttatctcgttcaaaaaaaattcattgtttattgtaagcgacaaaattagaagggagttaccagtatgcccctctaaactaagaattgttgatatagataagaaaacatgtttatccttttttatcgacgtgaataatgagctgcctggcaaatttactcttgataagaatggctatattgctgaagaggaacctccattatcgcttgttttttctctgtttgaagggattaaaatagcagactcacactccctttggttaaaagaaagactatgtatatccttacttgccatgttcaaaaaacgcgaaagtgtaaattcatttatactaacaaatataaatacatttacctgtaaaattactggaataatcagttttaatattgagcggcaatggcatttaaaagatattgcggaattgatttatacgagtgaaagtttaataaaaaaaagattaagggatgaaggaacgtcatttactgaaatattgagagatactaggatgaggtatgcaaaaaaactcataacttcaaactcttattctatcaatgtcgtagcccagaaatgtggctataacagtacttcatatttcatatgtgcatttaaagattattatggtgtcacgccatctcattattttgagaaaataatcggcgtcacagatggaataaacaaaacaattgactaataa BBa_J15001_sequence 1 ctcaaggagg BBa_K118007_sequence 1 ctcaaggaggtactagatggattatgtttgctccgtagttttcatctgtcaatcatttgatttaattataaacaggagagttatctcgttcaaaaaaaattcattgtttattgtaagcgacaaaattagaagggagttaccagtatgcccctctaaactaagaattgttgatatagataagaaaacatgtttatccttttttatcgacgtgaataatgagctgcctggcaaatttactcttgataagaatggctatattgctgaagaggaacctccattatcgcttgttttttctctgtttgaagggattaaaatagcagactcacactccctttggttaaaagaaagactatgtatatccttacttgccatgttcaaaaaacgcgaaagtgtaaattcatttatactaacaaatataaatacatttacctgtaaaattactggaataatcagttttaatattgagcggcaatggcatttaaaagatattgcggaattgatttatacgagtgaaagtttaataaaaaaaagattaagggatgaaggaacgtcatttactgaaatattgagagatactaggatgaggtatgcaaaaaaactcataacttcaaactcttattctatcaatgtcgtagcccagaaatgtggctataacagtacttcatatttcatatgtgcatttaaagattattatggtgtcacgccatctcattattttgagaaaataatcggcgtcacagatggaataaacaaaacaattgactaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z