BBa_K118021 1 BBa_K118021 PcstA+rbs+xylE 2008-10-06T11:00:00Z 2015-05-08T01:09:37Z The template DNA for ''xylE'' was kindly supplied by Dr. Peter Williams of the University of Wales, Bangor. pCstA is from ''Escherichia coli'' JM109 genomic DNA. Released HQ 2013 ''xylE'' is from the ''Pseudomonas putida'' TOL (naphthalene and xylene degradadative plasmid) pWW0. This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This is a useful reporter gene; colonies or broths expressing active XylE, in the presence of oxygen, will rapidly convert catechol, a cheap colourless substrate, to a bright yellow compound with an absorbance maximum around 377 nm. The part includes the native ribosome binding site, so simply has been added to the glucose-repressible promoter of ''cstA''. This allows for characterisation of pCstA over a range of glucose concentrations. false false _192_ 0 3282 9 In stock true No special considerations true Andrew Hall component1978604 1 BBa_K118011 component1978607 1 BBa_J33204 annotation1978604 1 BBa_K118011 range1978604 1 1 131 annotation1978607 1 BBa_J33204 range1978607 1 140 1097 BBa_J33204 1 BBa_J33204 xylE reporter gene with rbs 2006-10-16T11:00:00Z 2015-08-31T04:08:46Z The template DNA was kindly supplied by Dr. Peter Williams of the University of Wales, Bangor. The primer design was based on Genbank sequence M64747 (GI:151718). The sequence reported here was confirmed by sequencing the Biobrick construct. Released HQ 2013 This part includes the xylE gene from the Pseudomonas putida TOL (naphthalene and xylene degradadative plasmid) pWW0. This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This is a useful reporter gene; colonies or broths expressing active XylE, in the presence of oxygen, will rapidly convert catechol, a cheap colourless substrate, to a bright yellow compound with an absorbance maximum around 377 nm. The part includes the native ribosome binding site, so simply needs to be added after a suitable promoter to act as a reporter. I have previously used this gene to generate whole cell biosensors for various heavy metals. Note that, unlike Xgal etc., catechol in solution is prone to spontaneous oxidation resulting in brown melanin-like polymeric products, so is not stable enough to incorporate into plates or growth media; it should be dripped onto colonies (I use 10 mM catechol in water for this) or added to liquid cultures at a final concentration of about 0.5 mM prior to assay. Note also that there is a SacI site at the very start of the part, when the prefix is included, so this can be used as a replacement vector to introduce PCR products with SacI-SpeI ends into pSB1A2 giving them full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. false false _63_ 0 837 63 In stock true Note that this sequence includes the native ribsomome binding site. Also, when the prefix is included, there is a SacI site at the start, which allows this part to be used as a vector for insertion of PCR products with SacI-SpeI ends into pSB1A2, replacing xylE, giving the full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. true Chris French annotation1903407 1 cds range1903407 1 27 950 annotation1903406 1 rbs range1903406 1 14 19 BBa_K118011 1 BBa_K118011 PcstA (glucose-repressible promoter) 2008-08-18T11:00:00Z 2015-05-08T01:09:36Z ''Eschaerichia coli'' JM109 genomic DNA Released HQ 2013 This is the promoter for the ''Eschaerichia coli'' JM109 ''cstA'' gene. It includes the CRP-binding site and the RNA polymerase-binding site. Low glucose concentration results in increased activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to associate with the promoter and promote transcription of the downstream gene. (''cstA'' encodes the carbon starvation protein.) false true _192_ 0 3282 9 In stock true No special considerations true Andrew Hall annotation1972436 1 RNA polymerase binding site range1972436 1 101 131 annotation1972435 1 cAMP receptor protein binding site range1972435 1 1 42 BBa_J33204_sequence 1 ctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccgg BBa_K118011_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggaca BBa_K118021_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggacatactagagctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z