BBa_J15103 1 BBa_J15103 lacZ' coding sequence ending in TGA 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Eschericia coli BS. The sequence was derived from gi:146575. This is the same Escherichia coli lacZ' coding sequence as in BBa_J15102, encoding the N-terminal 76 amino acids of LacZ (beta galactosidase), except that it ends with TGA rather than the recommended TAATAA. It was mistakenly incorporated into several later constructs where we had intended to use BBa_J15012. It works exactly the same, but does not fully conform to the Registry recommendations for coding sequences. false false _163_ 0 837 163 Not in stock false Codon 77, normally TGC, was altered to TGA to truncate the sequence. false Chris French annotation1938054 1 lacZ' range1938054 1 1 231 annotation1938057 1 silent mutation codon 58 range1938057 1 174 174 annotation1938056 1 end lacZ' range1938056 1 229 231 annotation1938055 1 start lacZ' range1938055 1 1 3 BBa_K118027 1 BBa_K118027 PcstA + lacZ 2008-10-22T11:00:00Z 2015-05-08T01:09:37Z The cstA promoter and lacZ' are both from Escherichia coli. Released HQ 2013 This part consists of the cstA promoter, which is repressed by high levels of glucose, coupled to the lacZ' reporter gene for promoter activity assays. false false _192_ 0 837 163 In stock true No special considerations. true Chris French component1985191 1 BBa_J15103 component1985186 1 BBa_J15001 component1985183 1 BBa_K118011 annotation1985186 1 BBa_J15001 range1985186 1 140 149 annotation1985191 1 BBa_J15103 range1985191 1 156 386 annotation1985183 1 BBa_K118011 range1985183 1 1 131 BBa_J15001 1 BBa_J15001 strong synthetic E. coli ribosome binding site with SacI site. 2007-07-12T11:00:00Z 2015-08-31T04:08:32Z Synthetic. This is a strong synthetic E. coli ribosome binding site. It is synthesised as two complementary oligonucleotides rather than being incorporated into a biobrick plasmid. It incorporates a SacI site overlapping the XbaI site, which is preserved when it is added to any other biobrick. This allows easy detection of the RBS after it has been added upstream of a biobrick coding sequence in a plasmid vector. false false _163_ 0 837 163 Not in stock false Note the presence of a SacI site overlapping the XbaI site, which is preserved when this biobrick is added to any other biobrick. At the time of writing, this biobrick is added as a short piece of DNA composed of two complementary oligonucleotides rather than being incorporated into a biobrick cloning vector by itself. It can be added upstream of a biobrick coding sequence, and its presence can easily be detected in miniprep DNA on a gel by using a SacI-SpeI or similar digest. false Chris French annotation1938046 1 rbs range1938046 1 4 10 annotation1938045 1 SacI range1938045 1 1 3 BBa_K118011 1 BBa_K118011 PcstA (glucose-repressible promoter) 2008-08-18T11:00:00Z 2015-05-08T01:09:36Z ''Eschaerichia coli'' JM109 genomic DNA Released HQ 2013 This is the promoter for the ''Eschaerichia coli'' JM109 ''cstA'' gene. It includes the CRP-binding site and the RNA polymerase-binding site. Low glucose concentration results in increased activity by adenylate cyclase. cAMP binds to the cAMP receptor protein, which, in its bound form, is able to associate with the promoter and promote transcription of the downstream gene. (''cstA'' encodes the carbon starvation protein.) false true _192_ 0 3282 9 In stock true No special considerations true Andrew Hall annotation1972435 1 cAMP receptor protein binding site range1972435 1 1 42 annotation1972436 1 RNA polymerase binding site range1972436 1 101 131 BBa_K118027_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggacatactagagctcaaggaggtactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgagtggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K118011_sequence 1 actcggttaacggagtgatcgagttaacattgttaagttaaatattggtttcaactccgatttacatggttgctgtgttgttaaattgtacaaagatgttatagaaacaaaatgtaacatctctatggaca BBa_J15001_sequence 1 ctcaaggagg BBa_J15103_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgagtggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z