BBa_K1184000 1 BBa_K1184000 KillerRed 2013-09-03T11:00:00Z 2016-01-25T02:40:37Z Engineered from avGFP. Provided by the Bruchez lab at Carnegie Mellon KillerRed is a red fluorescent protein that produces reactive oxygen species (ROS) in the presence of yellow-orange light (540-585 nm). KillerRed is engineered from Aequorea victoria GFP (avGFP) to be phototoxic. It has been shown that KillerRed produces superoxide radical anions by reacting with water. Superoxide reacts with the chromophore of KillerRed, causing it to become dark, which ultimately gives rise to a bleaching effect. KillerRed is spectrally similar to mRFP1 with a similar brightness. KillerRed is oligomeric and may form large aggregates. This sequence is codon optimized for mammalian cells and has 14 rare proline codons for E. coli (CCC) and one rare arginine codon (AGA). Codon optimization should be taken into consideration if large amounts of the protein are required. Expression on a high-copy plasmid has produced detectable fluorescent signal, however. false false _1497_ 4206 12713 9 In stock true This sequence is not codon optimized for E. coli. false Eric Pederson annotation2334953 1 Double Stop range2334953 1 718 723 annotation2334960 1 Phototoxic Mutation Asn(147) range2334960 1 439 441 annotation2334958 1 Chromophore range2334958 1 199 207 annotation2334954 1 Start range2334954 1 1 3 annotation2334955 1 cds range2334955 1 1 717 annotation2334956 1 Phototoxic Mutation Glu(70) range2334956 1 208 210 annotation2334965 1 Phototoxic Mutation Ala(163) range2334965 1 487 489 annotation2334957 1 Phototoxic Mutation Ser(121) range2334957 1 367 369 BBa_K1184000_sequence 1 atgggttcagagggcggccccgccctgttccagagcgacatgaccttcaaaatcttcatcgacggcgaggtgaacggccagaagttcaccatcgtggccgacggcagcagcaagttcccccacggcgacttcaacgtgcacgccgtgtgcgagaccggcaagctgcccatgagctggaagcccatctgccacctgatccagtacggcgagcccttcttcgcccgctaccccgacggcatcagccatttcgcccaggagtgcttccccgagggcctgagcatcgaccgcaccgtgcgcttcgagaacgacggcaccatgaccagccaccacacctacgagctggacgacacctgcgtggtgagccgcatcaccgtgaactgcgacggcttccagcccgacggccccatcatgcgcgaccagctggtggacatcctgcccaacgagacccacatgttcccccacggccccaacgccgtgcgccagctggccttcatcggcttcaccaccgccgacggcggcctgatgatgggccacttcgacagcaagatgaccttcaacggcagccgcgccatcgagatccccggcccacacttcgtgaccatcatcaccaagcagatgagggacaccagcgacaagcgcgaccacgtgtgccagcgcgaggtggcctacgcccacagcgtgccccgcatcaccagcgccatcggtagcgacgaggattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z