BBa_K1185001 1 BBa_K1185001 HBsu-sfGFP 2013-08-28T11:00:00Z 2015-06-08T09:31:00Z The source of the HBsu coding sequence was the ''B. subtilis'' strain 168 genome, SwissProtTM accession number: P08821. The sfGFP sequence was sourced from BBa_E0040 and the linker from: BBa_K105012. This BioBrick codes for a HBsu protein attached to a superfolded green fluorescent protein (sfGFP). HBsu is a non-specific DNA binding protein that binds to DNA as a homodimer. The HBsu is joined to the sfGFP through ten amino acid flexible linker sequence. This allows the observation of ''Bacillus subtilis'' DNA using fluorescence microscopy. The integration strategy that we opted for was to clone in the BioBrick into the Multiple cloning site of pMutin4 backbone. First we attached HindIII restriction sites on 5'end and SacII restriction sites on 3'end of the BioBrick. We then cut the pMutin4 backbone and BioBrick using the previously mentioned restriction enzymes, this allowed us to ligate the plasmid and BioBrick together. We also attached a ~300bp amyE homology region onto the 3'end of the BioBrick after the SacII to allow the single cross over and integration of the whole plasmid into the genome. The pMutin4 plasmid contains a ery+ resistance marker for ''B.subtilis'' and amp+ for ''E.coli'' and also contains lacI, lacZ and Pspac promoter which is an IPTG induced promoter which regulated the transcription of this BioBrick. An alternative method to use this part would be to clone this BioBrick out and use any Assembly protocol to attach a desired promoter, RBS and antibiotic resistance genes. false false _1498_ 4206 16794 9 It's complicated false None false Vincent Leonardo annotation2333334 1 linker sequence BBa_K105012 range2333334 1 297 326 annotation2333336 1 3-frame stop codon range2333336 1 1047 1054 annotation2333335 1 sfGFP_BBa_I746916 range2333335 1 327 1046 annotation2333332 1 hbs range2333332 1 21 296 annotation2333331 1 RBS-with post spacer range2333331 1 1 20 BBa_K1185001_sequence 1 tttgggaggaggtgaaaggcatgaacaaaacagaacttatcaatgcggttgcagaagcaagcgaattgtctaaaaaagacgctacaaaagcagttgactctgtttttgatacgatcttagatgcacttaaaaacggtgataaaatccaactgatcggttttggtaacttcgaggtgcgtgaacgttctgcacgtaaaggacgcaatcctcaaacaggtgaagaaatcgaaattccagcaagcaaagtacctgctttcaaaccaggtaaagcgcttaaagacgcagttgccggaaaaggtgaaaatttgtattttcaatctggtggtatgcgtaaaggcgaagagctgttcactggtgtcgtccctattctggtggaactggatggtgatgtcaacggtcataagttttccgtgcgtggcgagggtgaaggtgacgcaactaatggtaaactgacgctgaagttcatctgtactactggtaaactgccggtaccttggccgactctggtaacgacgctgacttatggtgttcagtgctttgctcgttatccggaccatatgaagcagcatgacttcttcaagtccgccatgccggaaggctatgtgcaggaacgcacgatttcctttaaggatgacggcacgtacaaaacgcgtgcggaagtgaaatttgaaggcgataccctggtaaaccgcattgagctgaaaggcattgactttaaagaagacggcaatatcctgggccataagctggaatacaattttaacagccacaatgtttacatcaccgccgataaacaaaaaaatggcattaaagcgaattttaaaattcgccacaacgtggaggatggcagcgtgcagctggctgatcactaccagcaaaacactccaatcggtgatggtcctgttctgctgccagacaatcactatctgagcacgcaaagcgttctgtctaaagatccgaacgagaaacgcgatcatatggttctgctggagttcgtaaccgcagcgggcatcacgcatggtatggatgaactgtacaaatgataagtaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z