BBa_K1185002 1 BBa_K1185002 HBsu-RFP 2013-08-28T11:00:00Z 2015-06-08T09:30:41Z The source of the HBsu coding sequence was the ''B. subtilis'' strain 168 genome, SwissProtTM accession number: P08821. The RFP sequence was sourced from BBa_E1010 and the linker from: BBa_K105012. This BioBrick codes for a HBsu protein attached to a red fluorescent protein (RFP). HBsu is a non-specific DNA binding protein that binds to DNA as a homodimer. The HBsu is joined to the RFP through ten amino acid flexible linker sequence. This allows the observation of ''Bacillus subtilis'' DNA using fluorescence microscopy. The integration strategy that we opted for was to clone in the BioBrick into the Multiple cloning site of pMutin4 backbone. First we attached HindIII restriction sites on 5'end and SacII restriction sites on 3'end of the BioBrick. We then cut the pMutin4 backbone and BioBrick using the previously mentioned restriction enzymes, this allowed us to ligate the plasmid and BioBrick together. We also attached a ~300bp amyE homology region onto the 3'end of the BioBrick after the SacII to allow the single cross over and integration of the whole plasmid into the genome. The pMutin4 plasmid contains a ery+ resistance marker for ''B.subtilis'' and amp+ for ''E.coli'' and also contains lacI, lacZ and Pspac promoter which is an IPTG induced promoter which regulated the transcription of this BioBrick. An alternative method to use this part would be to clone this BioBrick out and use any Assembly protocol to attach a desired promoter, RBS and antibiotic resistance genes. false false _1498_ 4206 16794 9 In stock false None false Vincent Leonardo annotation2333322 1 linker sequence_BBa_K105012 range2333322 1 297 326 annotation2333320 1 RBS-with post spacer range2333320 1 1 20 annotation2333324 1 RFP_BBa_E1010 range2333324 1 327 1004 annotation2333321 1 hbs range2333321 1 21 296 annotation2333326 1 3-frame stop codon range2333326 1 1005 1012 BBa_K1185002_sequence 1 tttgggaggaggtgaaaggcatgaacaaaacagaacttatcaatgcggttgcagaagcaagcgaattgtctaaaaaagacgctacaaaagcagttgactctgtttttgatacgatcttagatgcacttaaaaacggtgataaaatccaactgatcggttttggtaacttcgaggtgcgtgaacgttctgcacgtaaaggacgcaatcctcaaacaggtgaagaaatcgaaattccagcaagcaaagtacctgctttcaaaccaggtaaagcgcttaaagacgcagttgccggaaaaggtgaaaatttgtattttcaatctggtggtatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaggcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaggcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaagtaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z