BBa_K1188002 1 BBa_K1188002 RTX - Calcium Binding Protein 2013-08-22T11:00:00Z 2015-05-08T01:09:37Z J Biol Chem. 2011 May 13;286(19):16997-7004 http://www.ncbi.nlm.nih.gov/pubmed/21454565 RTX (repeats-in-toxin) is a polypeptide motif consisting of a repeating sequence of amino acids. It undergoes a conformation change in the presence of calcium which causes it to precipitate from solution. This is the shorter (8-mer) version of this part, and is in Freiburg format. This allows RTX to be fused to itself to create a longer RTX chain, or to other proteins which can then be precipitated from a solution. This is useful for the purpose of protein purification, or alternatively to remove an unwanted protein from a solution. false false _1501_ 0 17738 9 In stock false We ordered PCR primers to isolate RTX from its original construct. Due to the repetitive nature of this construct, we found that there were multiple binding sites for the forward primer which resulted in two products. This is the shorter PCR product, with only 8 repeats, whereas the original construct had 17. false Jean-Francois Lalonde BBa_K1188002_sequence 1 atggccggcggtgcgggcaacgataccctgtatggtggcgccgggaatgacacattatacggaggtgctggcaatgatacgctgtatggcggagcaggtaacgacactttgtatgggggcgccggtaacgacacgctgtatgggggggcaggcaacgataccctttatggcggtgctgggaatgacacactgtacggcggggcgggtaacgataccctctataccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z