BBa_K1188003 1 BBa_K1188003 FMN-binding protein 2013-09-04T11:00:00Z 2015-05-08T01:09:37Z FMN-binding protein from Desulfovibrio vulgaris. This part is a short (~370 bp) flavin mononucleotide (FMN)-binding protein that has Freiburg restriction sites in order to create fusion proteins. This can be used to tag proteins for the purpose of characterizing the amount of expressed protein, which can be measured by the absorption of visible light at 375 and 440 nm. false false _1501_ 0 17738 9 It's complicated false This sequence for this part was synthesized by IDT, then cloned into a standard biobrick vector. false William Heymann BBa_K1188003_sequence 1 atggccggccttcctggcacgttcttcgaagtccttaaaaacgagggagttgttgccattgcaacgcaaggcgaagatggccctcacctggtcaacacgtggaactcttatttaaaggtgcttgatggaaaccgtattgttgtgccggtcggtggtatgcataaaaccgaagctaatgtagcgcgtgatgaacgcgttctgatgaccctgggaagccgtaaggtggcgggtcgtaacggtccggacaccggcttcctgatccgtggtagtgcagcctttcgcaccgatggcccggagttcgaggccatcgcacgatttaaatgggcccgcgccgcgctagttattacggtggtatcagccgaacagaccctgaccggttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z