BBa_K1190001 1 BBa_K1190001 Granulocyte Macrophage Colony-Stimulating Factor 2013-08-29T11:00:00Z 2015-05-08T01:09:38Z Homo sapiens Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine that functions as a white blood cell growth factor. GM-CSF stimulates stem cells to produce granulocytes (neutrophils, eosinophils, and basophils) and monocytes. Monocytes exit the circulation and migrate into tissue, whereupon they mature into macrophages and dendritic cells. Thus, it is part of the immune/inflammatory cascade, by which activation of a small number of macrophages can rapidly lead to an increase in their numbers, a process crucial for fighting infection. The active form of the protein is found extracellularly as a homodimer. false false _1504_ 0 9215 9 It's complicated false We synthesized the part codon-optimized for E. coli K12 and created silent mutations at all biobrick cut sites in the natural protein. false Nisarg Patel BBa_K1190001_sequence 1 atgtggttacagagtctcttgctgttgggcacagtggcctgctctatttcggccccggcccgtagcccatctccgtctacccagccttgggagcatgttaatgctatccaggaagcccgtcgcctgctgaacttaagccgcgacacggcagctgagatgaacgaaacggtcgaagttatttcggaaatgtttgacctgcaagaacctacgtgtttacagacccgtcttgagctgtataagcaggggctgcgcggctctctgacaaaactgaaaggcccactgactatgatggcgtctcattacaaacaacactgcccaccgacgccggaaacttcttgtgctacacagattattacttttgaaagttttaaagaaaatttgaaggactttttactggtaattcctttcgattgctgggagcctgtgcaggaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z